Clone Read LE_HBa0135E10_SP6_61266

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0135E10_SP6_61266
Primer
SP6
ID from Seq. Facility
LE_HBa_135_E10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
412 trimmed for vector and quality, 824 raw
Genbank Accession
Sequence
>LE_HBa0135E10_SP6_61266 (raw untrimmed)
AAATCGATACGAAACAACAAATTTCCTCGAAAGCCCCTTTAATATTCCACCAAGCATGAAATCAATCTGATCAAGAACACTTCCAGTTAGAAATTGGAGC
AAACATGAAATTGATCCACTCTCCACATATGATGAGTCAAAATAGTCAATTGCAGAGCTCTCATTCCCAGTTTGCACACTCTACTAGTAGTGTCTATCAT
CTGCCATTTGACGGAGCTACTTCTGTTTCTGGATTCAAATCGTGGTTACGCCAGGCTTCTGTTGCTGCACCATTAATGTCGTCAGCTGAAGAAATTGTAA
ATCCTAGCAATTGCCAGGCGCTCTCGCTTGCAGCCGCTCCCAAAAAACGGCCGGTAGCAGTTAAAAATGGTGGTGGTTCAAAGGAATCAGTTCCGCGCAA
ATCCATCTGATACTTTTGGGCAAAGAACTTCTCATTACCGCGGAGTCACCATGTACTAATTCAACTATTTATTTTTTTTGAAAAAAAAAAATCTACTCTA
TATTATAGTTATGTTAAACTCGTGATAAAATATATGTTATACTTATTTTTTTCTAAATTCATTTTGAATAATTTTTATTTTTTGATATTGAAGTTTGATC
CATTTATTAATCCGGTGGAATGGAATAATACGATGCTGGATTGTGGGATAAATTCGTTTAAAAATAATATGTATATCTCAGTAAATGTTTTATTAAGGTT
TGTTTACTCTGACATTTACTTTTTCTTTTTGATTTTATCTAAGGTCAATATTGGAATTTTAATGTCTATATATTATTCTATAGTTATCTATTTTCAGCTT
TCTTCTGGGATTTTCTTTATTTTT
>LE_HBa0135E10_SP6_61266 (trimmed for quality and cloning vector)
CAGTTAGAAATTGGAGCAAACATGAAATTGATCCACTCTCCACATATGATGAGTCAAAATAGTCAATTGCAGAGCTCTCATTCCCAGTTTGCACACTCTA
CTAGTAGTGTCTATCATCTGCCATTTGACGGAGCTACTTCTGTTTCTGGATTCAAATCGTGGTTACGCCAGGCTTCTGTTGCTGCACCATTAATGTCGTC
AGCTGAAGAAATTGTAAATCCTAGCAATTGCCAGGCGCTCTCGCTTGCAGCCGCTCCCAAAAAACGGCCGGTAGCAGTTAAAAATGGTGGTGGTTCAAAG
GAATCAGTTCCGCGCAAATCCATCTGATACTTTTGGGCAAAGAACTTCTCATTACCGCGGAGTCACCATGTACTAATTCAACTATTTATTTTTTTTGAAA
AAAAAAAATCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97047
Expected error %
1.45832
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0135E10
Clone
Clone name
hba-135e10
LE_HBa0135E10
P135E10
Clone type
BAC
Contamination
none
Estimated length
77,049
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found