Clone Read LE_HBa0042B06_SP6_62650

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0042B06_SP6_62650
Primer
SP6
ID from Seq. Facility
LE_HBa_042_B06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
784 trimmed for vector and quality, 800 raw
Genbank Accession
Sequence
>LE_HBa0042B06_SP6_62650 (raw untrimmed)
GCATGCTTGAGCACATGTGGTCTTGTCTAGCTCTAGACTCAAATGAATAAAGTTGTCTTCGTGTGACTTATACGTTATGGATTTGATCCGTGGAATCAGC
CACTAATACTTGTATTAGGGAGGCTGCCTACATCTTACTTCCTTGGTGTGAGGCCCTTCCACTATTCTGCATGAATGCGGTATGCTATATGCACTGGGCT
GCTTTTTTTATATGTGCATCTCAATAATCACTTGAAAGGCTCATAACTATCCTTGCAGTGAATTCCTTCTGATACTTTTATTTTCTGAAGTAGTTTATCT
GATACAGATTCTGCTATTCTTTTTTTCTTTTAGATGACTTTTTTTCTAGCTATTGTAATATGATTCTGCTAGCTGTAGCAGTTTTCTTCTGTTTTTAATC
AGATTATTAGCATCTCGCACATTGAAATGAGCTGGTAGAAATCCTATATTGTCAAAAATAGTTGCTCTTTATATACTTTATTCATGTCTAATAACTTGTC
AATTGGTGAATGTTGCCATCTCATTTCAGTATATTGCAGAGGTGAAAGTGGTGGTGGTGTTTGATGCTATGATGTCTGGAATGGCTACACACAAGGAAGA
CTTTGAGGGGTAATTACATTAGACAATGAAAAACAACCCCATAGTTACCTTCTGTGGATATTTTTCTGTCTTACAGACAGGCTCTTGGAATTTGCTATTA
TTTTTCTGCTCGTCTGTCATTACTGTAGTTTCACATGAAATCAGATTCTTGTCCTCCTTTCAATAGGTAATATGTAAATGTGCTGTTGCATACTAATGCT
>LE_HBa0042B06_SP6_62650 (trimmed for quality and cloning vector)
TGTGGTCTTGTCTAGCTCTAGACTCAAATGAATAAAGTTGTCTTCGTGTGACTTATACGTTATGGATTTGATCCGTGGAATCAGCCACTAATACTTGTAT
TAGGGAGGCTGCCTACATCTTACTTCCTTGGTGTGAGGCCCTTCCACTATTCTGCATGAATGCGGTATGCTATATGCACTGGGCTGCTTTTTTTATATGT
GCATCTCAATAATCACTTGAAAGGCTCATAACTATCCTTGCAGTGAATTCCTTCTGATACTTTTATTTTCTGAAGTAGTTTATCTGATACAGATTCTGCT
ATTCTTTTTTTCTTTTAGATGACTTTTTTTCTAGCTATTGTAATATGATTCTGCTAGCTGTAGCAGTTTTCTTCTGTTTTTAATCAGATTATTAGCATCT
CGCACATTGAAATGAGCTGGTAGAAATCCTATATTGTCAAAAATAGTTGCTCTTTATATACTTTATTCATGTCTAATAACTTGTCAATTGGTGAATGTTG
CCATCTCATTTCAGTATATTGCAGAGGTGAAAGTGGTGGTGGTGTTTGATGCTATGATGTCTGGAATGGCTACACACAAGGAAGACTTTGAGGGGTAATT
ACATTAGACAATGAAAAACAACCCCATAGTTACCTTCTGTGGATATTTTTCTGTCTTACAGACAGGCTCTTGGAATTTGCTATTATTTTTCTGCTCGTCT
GTCATTACTGTAGTTTCACATGAAATCAGATTCTTGTCCTCCTTTCAATAGGTAATATGTAAATGTGCTGTTGCATACTAATGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946903
Expected error %
0.223409
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0042B06
Clone
Clone name
hba-42b6
LE_HBa0042B06
P042B06
Clone type
BAC
Contamination
none
Estimated length
67,916
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found