Clone Read LE_HBa0042G04_T7_62887

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0042G04_T7_62887
Primer
T7
ID from Seq. Facility
LE_HBa_042_G04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
721 trimmed for vector and quality, 925 raw
Sequence
>LE_HBa0042G04_T7_62887 (raw untrimmed)
CAAACCCTGGTCCCCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATATCAGATAGTTGAGACCCTTTTAAGTTGCCGCTTTGAAGTGAC
TGATCCTGCCTCTGCCTTAGTGGTACTGATGAAGATACTTCAGGTTCTTTTGGCTTGCATGAAAAGTAAGGCATCAGAAAATTTAAGTAATCATCACGTG
TGCAACATTGTAAACACTTGCTTTCGGCTTGTTCATCAAGCTAGTGCCAAAAGTGAACTGCTGCAGAGAATAGCAAGACACACAATGCATGAATTGGTGA
GACACATTTTCGCTCACCTGCCTAACATTATCAGCAAAGCGCATGAATTTGATCAGCAAAGCAGATTGTGTGCTGACTCAGAGGTAATTGGGACTCTCGA
TTTATATTGTTACATTTGCTTTTATGATTTTTTTTATGTTTCTTTTGAATGAGACCATAGCTGCATGTGCTAGTGATTCTTGGCCAGAAATGACTTGTTA
AATGTTCAGTTGAAATTAAAAAATAAATATTAGAATTGAAAATTGGCCTTTTGGGTTGAGCCTATGGTGACCCTTATTCAAACCTTGTTAACTTTTGCTC
TCATTCATAATTTGTTGGAGTTTGCATGTGGCTTATCCTCATCTCATAGATGAGTTTGGTGATAGGCCAAAGTACTCAACATTTCTGCCATAATCTTGTC
TAAATCTGAACTTTCTGATGTAATTGCTTCAGTTTGACCAGATAACTGTTCAAGAAGTCCCTGAATTACAGTACTTGTCCTCTTGTAATTTTAAATTTCA
GTATTTGACTGACCATGTGTATTTTTTCCCCTTTAATGGTTAGTTCAAATCCCATTTTGTTGTCATGAGGTAGTAGCCCGCCAGGATTGTTTGCTTGATG
GGGATTGAATTTTATGAATAATTAA
>LE_HBa0042G04_T7_62887 (trimmed for quality and cloning vector)
AGCTTTATATCAGATAGTTGAGACCCTTTTAAGTTGCCGCTTTGAAGTGACTGATCCTGCCTCTGCCTTAGTGGTACTGATGAAGATACTTCAGGTTCTT
TTGGCTTGCATGAAAAGTAAGGCATCAGAAAATTTAAGTAATCATCACGTGTGCAACATTGTAAACACTTGCTTTCGGCTTGTTCATCAAGCTAGTGCCA
AAAGTGAACTGCTGCAGAGAATAGCAAGACACACAATGCATGAATTGGTGAGACACATTTTCGCTCACCTGCCTAACATTATCAGCAAAGCGCATGAATT
TGATCAGCAAAGCAGATTGTGTGCTGACTCAGAGGTAATTGGGACTCTCGATTTATATTGTTACATTTGCTTTTATGATTTTTTTTATGTTTCTTTTGAA
TGAGACCATAGCTGCATGTGCTAGTGATTCTTGGCCAGAAATGACTTGTTAAATGTTCAGTTGAAATTAAAAAATAAATATTAGAATTGAAAATTGGCCT
TTTGGGTTGAGCCTATGGTGACCCTTATTCAAACCTTGTTAACTTTTGCTCTCATTCATAATTTGTTGGAGTTTGCATGTGGCTTATCCTCATCTCATAG
ATGAGTTTGGTGATAGGCCAAAGTACTCAACATTTCTGCCATAATCTTGTCTAAATCTGAACTTTCTGATGTAATTGCTTCAGTTTGACCAGATAACTGT
TCAAGAAGTCCCTGAATTACA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947789
Expected error %
0.751834
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g13980.1 Score 143 E Value 1e-34 Identity 24.40% Align. Length 278bp (38.56%) Frame 3
68414.m01647 pattern formation protein (EMB30) (GNOM) identical to SP|Q42510; contains Pfam profile PF01369: Sec7 domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g39500.1 Score 139 E Value 1e-33 Identity 21.70% Align. Length 350bp (48.54%) Frame 3
68418.m04783 pattern formation protein, putative similar to SP|Q42510 Pattern formation protein EMB30 {Arabidopsis thaliana}; contains Pfam profile PF01369: Sec7 domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAA91150.1| Score 143 E Value 5e-33 Identity 24.40% Align. Length 278bp (38.56%) Frame 3
GNOM gene product
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD39284.1| Score 143 E Value 5e-33 Identity 24.40% Align. Length 278bp (38.56%) Frame 3
EMB30/GNOM gene product [Arabidopsis thaliana] gb|AAF79403.1| F16A14.20 [Arabidopsis thaliana] ref|NP_172851.1| pattern formation protein (EMB30) (GNOM) [Arabidopsis thaliana] pir||S65571 pattern formation protein GNOM - Arabidopsis thaliana gb|AAB01206.1| similar to the Saccharomyces cerevisiae Sec7 protein, GenBank Accession Number J03918 gb|AAB01205.1| similar to the Saccharomyces cerevisiae Sec7 protein, GenBank Accession Number J03918 gb|AAA91151.1| GNOM gene product sp|Q42510|EM30_ARATH Pattern formation protein EMB30
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0042G04
Clone
Clone name
hba-42g4
LE_HBa0042G04
C02HBa0042G04
P042G04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found