Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0042G19_SP6_62916

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0042G19_SP6_62916
Primer
SP6
ID from Seq. Facility
LE_HBa_042_G19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
597 trimmed for vector and quality, 830 raw
Sequence
>LE_HBa0042G19_SP6_62916 (raw untrimmed)
TCTTGTTCAAGTATGTGATGATTGTGATTCTATGATATGTTGGTTTGTACTTCATTGTGATGCATGTTTATATGCGGAAATTGCATTATTTTGATCACAC
TTTTTTAAATTAATATGAAGAAATACCTATATGTTATGAATCACTTCTTGATTTTATGATATTGAAAATATACTTGTGTTTGTGATTGCGGTGTGTGGAA
AGGATCGGCATCCTCATTTCGGCATGACTAATTGGGATCAATTGTCACATTCCTGCATAAAGATCGGATTGATAGTCACATTCGACATAACTATTGGATC
AGGTGCCATGTTTTTGTATGCTAACATTTTGAGATTAGGTTCCATGAGAGGACAAACTACTTGACATAATTTTCTATCTTGAGAATATTGAAATTGTACG
TTGTTCATAGATATTGATAATATTGTATATGTTCGATACTTTGCATGATTACGATGTTGTATAGACTTGGTTATGTTACAATTAGTGGGATAGTCTTGTG
GTTCCATCAGTACAGTGTGGTTGTGTACTGATACTGAACCTGCTCTTATTTTTGTTGAGTATAGGGTATATTTTGGCAGATATTGTCTGACCTTTTCATG
AAGATCATTGATGTTGTTCGAATCCAAGTGTGAATAAACTCTTCCGGGCTTCCATGAGCTATCCTTTCTTCTATGTCCACATTTTTGGAACTTTGGACTT
TTGTTGTTAGTTAATAATTAATCGCGTCTTGTTTAAATTTTAATTCCCTCGTTAATTTACTTTAAGGGTACATTGAACTTCCAGGGTTCCAGGGGAATAT
CCCTTTCCCAATTATATTTGGGTAAATTAT
>LE_HBa0042G19_SP6_62916 (trimmed for quality and cloning vector)
GATTGTGATTCTATGATATGTTGGTTTGTACTTCATTGTGATGCATGTTTATATGCGGAAATTGCATTATTTTGATCACACTTTTTTAAATTAATATGAA
GAAATACCTATATGTTATGAATCACTTCTTGATTTTATGATATTGAAAATATACTTGTGTTTGTGATTGCGGTGTGTGGAAAGGATCGGCATCCTCATTT
CGGCATGACTAATTGGGATCAATTGTCACATTCCTGCATAAAGATCGGATTGATAGTCACATTCGACATAACTATTGGATCAGGTGCCATGTTTTTGTAT
GCTAACATTTTGAGATTAGGTTCCATGAGAGGACAAACTACTTGACATAATTTTCTATCTTGAGAATATTGAAATTGTACGTTGTTCATAGATATTGATA
ATATTGTATATGTTCGATACTTTGCATGATTACGATGTTGTATAGACTTGGTTATGTTACAATTAGTGGGATAGTCTTGTGGTTCCATCAGTACAGTGTG
GTTGTGTACTGATACTGAACCTGCTCTTATTTTTGTTGAGTATAGGGTATATTTTGGCAGATATTGTCTGACCTTTTCATGAAGATCATTGATGTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.925439
Expected error %
0.179127
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0042G19
Clone
Clone name
hba-42g19
LE_HBa0042G19
P042G19
Clone type
BAC
Contamination
none
Estimated length
77,895
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found