Clone Read LE_HBa0048D15_SP6_63532

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048D15_SP6_63532
Primer
SP6
ID from Seq. Facility
LE_HBa_048_D15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
661 trimmed for vector and quality, 824 raw
Genbank Accession
Sequence
>LE_HBa0048D15_SP6_63532 (raw untrimmed)
GTTTCGGCATCTTACCCTCATGAGATTATTTTAGGGGTCGAGTGAGGCCCTAGTGCTATATCTTTACCAAAAAGTAGGCAGATAATGGAAGTTCACTGTA
CTAACCAATTTTTGTTTAGAATCACTGTATTATGAATGACATTTGTATCTTAATCTCTGAAATCCAGGACTCTCTCAGATTATCTTGGGCAAGGAACCAT
GTTAGCAATTGTTTGCAAGACGCTTGATGGACTTAAAGCACTGGAAACATATGATAAGGAAGGTCTTATAATTAAAAGTTCTGGTCTTCATGGAGTTGGA
GCTTCAATTGGAAGACCTTTGGATGACCGATATCTTGTAATTTGTCTTGAGAACTTAAGGTTTGTGGTTATGATGATCTCTTCTTGCAAATACATCTCAT
ATTGTTTAACACTTCTTTACTCTCTTATTTTTTCATTTTTGGGTTTATCATTTTAGACCATACACCAGTGAATTTATTGCTGATGACCCTCAGAGAAGGC
TGTCCATAAAGAAGCCAAGATACGTCAACGGGAAAACTCTTCCTGGTTTTCTTGGTTTTGCTGTCAATATGATCAATATTGACACTGATAACTTATATTG
TGTTACAAGCAATGGTCATGGACTGAGAGAGACCCTCTTCTATGGACTCTTCTCACAGTTGCAAGTATACAAAACAAGGGCAGACATGATGCAGGCACTA
CCCTTTATAGCTGGTGGAGCCATATCATTGGATGGTGGGATCATAAAGAGTGCTGGTTTATTTTCCCTAGGCAAAAGGGAAAGAGATTTTATCTTAAATA
TTGCGTTTATATTCATAATTTTTT
>LE_HBa0048D15_SP6_63532 (trimmed for quality and cloning vector)
GGGGTCGAGTGAGGCCCTAGTGCTATATCTTTACCAAAAAGTAGGCAGATAATGGAAGTTCACTGTACTAACCAATTTTTGTTTAGAATCACTGTATTAT
GAATGACATTTGTATCTTAATCTCTGAAATCCAGGACTCTCTCAGATTATCTTGGGCAAGGAACCATGTTAGCAATTGTTTGCAAGACGCTTGATGGACT
TAAAGCACTGGAAACATATGATAAGGAAGGTCTTATAATTAAAAGTTCTGGTCTTCATGGAGTTGGAGCTTCAATTGGAAGACCTTTGGATGACCGATAT
CTTGTAATTTGTCTTGAGAACTTAAGGTTTGTGGTTATGATGATCTCTTCTTGCAAATACATCTCATATTGTTTAACACTTCTTTACTCTCTTATTTTTT
CATTTTTGGGTTTATCATTTTAGACCATACACCAGTGAATTTATTGCTGATGACCCTCAGAGAAGGCTGTCCATAAAGAAGCCAAGATACGTCAACGGGA
AAACTCTTCCTGGTTTTCTTGGTTTTGCTGTCAATATGATCAATATTGACACTGATAACTTATATTGTGTTACAAGCAATGGTCATGGACTGAGAGAGAC
CCTCTTCTATGGACTCTTCTCACAGTTGCAAGTATACAAAACAAGGGCAGACATGATGCAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954072
Expected error %
0.0488889
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g49250.1 Score 112 E Value 3e-40 Identity 67.90% Align. Length 528bp (79.88%) Frame 2
68416.m05382 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g24280.1 Score 84 E Value 1e-24 Identity 37.30% Align. Length 564bp (85.33%) Frame 2
68418.m02856 expressed protein ; expression supported by MPSS
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD81389.1| Score 113 E Value 6e-45 Identity 63.70% Align. Length 525bp (79.43%) Frame 2
unknown protein [Oryza sativa (japonica cultivar-group)] dbj|BAD81261.1| unknown protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL90947.1| Score 112 E Value 1e-38 Identity 67.90% Align. Length 528bp (79.88%) Frame 2
AT3g49250/F2K15_110 [Arabidopsis thaliana] gb|AAK83630.1| AT3g49250/F2K15_110 [Arabidopsis thaliana] ref|NP_566916.1| expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048D15
Clone
Clone name
hba-48d15
LE_HBa0048D15
P048D15
Clone type
BAC
Contamination
none
Estimated length
115,438
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found