Clone Read LE_HBa0048F06_T7_63611

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048F06_T7_63611
Primer
T7
ID from Seq. Facility
LE_HBa_048_F06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
771 trimmed for vector and quality, 817 raw
Genbank Accession
Sequence
>LE_HBa0048F06_T7_63611 (raw untrimmed)
CTTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCAAAATGAAATTTTTTAACCATTTTCCCCATGTAAACTATAGACTGATA
CCTGGAAGGTCCCATGGGGAGAACTTGTAGATGTTGAGTTCCGTTATGCCTTCAAAATGAAGTTTTTTTCCTGTGATCTTACGTTTGAGATAGTACATAA
TCAGCTCAACATCAGTAGGGTGAAAACGAAACCCAGGCGGAAGCCTTGCCATCAAATGATCCCAAAAAAAAAAAGGAACTAAATTCAAAGCAGCCCAAAA
GGGGTGCGCCTGACGAAATCTAGACTAAACGAGCTATCTGCACAACACACCAGAGCCTCCAACCGACCCCTAAAACAAAAAAAATCTCAACTGCTGTCAA
GTCCAATGCCGAAACAGTATCTTCCCTGAGCACCACAACCTTCTGCGGTTCATGAAAAGGAATGCGCTCCAAACAAAGAAATGGTGCTTCTTGCTGGAGC
CAACAGACATCTGGTGCACAATCAAAAACCTGTTATTCATAAAATCATCAGCCTCGGGTATCAATACCTAATTATACGAACAAAAGAAGCTCCACTAGAT
CACTGCGTCCAAAGCAGACACCTCCATAACCAGCACAAATAACAAAAGAATCCCAGGTTGACAAACATCAAATTGACAGTAAAACAAATAAATAAACTTC
ATCTAGAAAAAACTTAAGCCCTAATCACTAAATTTGAACATTGATTCACCAGGATGAGCACAACTAAACCAATTACAGACATAGTCTCCCCATTTACACT
TCACGTGGGAAAAATAG
>LE_HBa0048F06_T7_63611 (trimmed for quality and cloning vector)
AGCTTAGCAAAATGAAATTTTTTAACCATTTTCCCCATGTAAACTATAGACTGATACCTGGAAGGTCCCATGGGGAGAACTTGTAGATGTTGAGTTCCGT
TATGCCTTCAAAATGAAGTTTTTTTCCTGTGATCTTACGTTTGAGATAGTACATAATCAGCTCAACATCAGTAGGGTGAAAACGAAACCCAGGCGGAAGC
CTTGCCATCAAATGATCCCAAAAAAAAAAAGGAACTAAATTCAAAGCAGCCCAAAAGGGGTGCGCCTGACGAAATCTAGACTAAACGAGCTATCTGCACA
ACACACCAGAGCCTCCAACCGACCCCTAAAACAAAAAAAATCTCAACTGCTGTCAAGTCCAATGCCGAAACAGTATCTTCCCTGAGCACCACAACCTTCT
GCGGTTCATGAAAAGGAATGCGCTCCAAACAAAGAAATGGTGCTTCTTGCTGGAGCCAACAGACATCTGGTGCACAATCAAAAACCTGTTATTCATAAAA
TCATCAGCCTCGGGTATCAATACCTAATTATACGAACAAAAGAAGCTCCACTAGATCACTGCGTCCAAAGCAGACACCTCCATAACCAGCACAAATAACA
AAAGAATCCCAGGTTGACAAACATCAAATTGACAGTAAAACAAATAAATAAACTTCATCTAGAAAAAACTTAAGCCCTAATCACTAAATTTGAACATTGA
TTCACCAGGATGAGCACAACTAAACCAATTACAGACATAGTCTCCCCATTTACACTTCACGTGGGAAAAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951087
Expected error %
0.557783
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g17260.1 Score 79 E Value 3e-15 Identity 22.90% Align. Length 152bp (19.71%) Frame 3
68418.m02022 no apical meristem (NAM) family protein contains Pfam PF02365: No apical meristem (NAM) domain;
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g65910.1 Score 79 E Value 4e-15 Identity 21.60% Align. Length 152bp (19.71%) Frame 3
68414.m07479 no apical meristem (NAM) family protein similar to jasmonic acid 2 GI:6175246 from [Lycopersicon esculentum]; similar to NAC2 (GI:6456751) {Arabidopsis thaliana}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM34765.1| Score 102 E Value 1e-20 Identity 29.40% Align. Length 152bp (19.71%) Frame 3
nam-like protein 2 [Petunia x hybrida]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV25009.1| Score 80 E Value 8e-14 Identity 22.70% Align. Length 149bp (19.33%) Frame 3
unknow protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048F06
Clone
Clone name
hba-48f6
LE_HBa0048F06
P048F06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found