Clone Read LE_HBa0048I16_SP6_63774

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048I16_SP6_63774
Primer
SP6
ID from Seq. Facility
LE_HBa_048_I16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
321 trimmed for vector and quality, 912 raw
Genbank Accession
Sequence
>LE_HBa0048I16_SP6_63774 (raw untrimmed)
GGGTTTTGATCCACCACCAACCTTGGGGGAGTAACTAACTTATCTTTATTTAAAAAATTGATGGAAACTAGTTGCACATTACCCTAGGTCTCCATTCTCT
CTTGCCAAAATGTGTGCAAGAATCATGAGCGGTTTAGGGGAAATTTTTGAATAAACTCATGACTAATTCAGCTATAGTGGCTCCGCCATAGCAGGACAAC
CCGATACAATGGTTTTGCTATAATGGGACCACCTGCTATAGTGGCTTCGCCATACCAGGAGCACTCACAATTGAAGGAACCAATTTCCCCCCTATAGCAT
CTTAACACCCCTATAGAGGCTTACACAAAAAATAAACTCATAATTCGTTCCAAAATATATTTATTTTGAACTACTCCTTTGCACTTTGACGTTTAAATTA
ACTCTTCTACACCAAGTCCGATATCGAGAACTTTACTTGACCCAATTCAACTATGACATTTCTTTTGTTTTTTTTATTTTCGTAATAAAAAATATTCTAA
CTCAATTCTTAATTATTTTACCTAACTTCTTATCATATTTTCGTTGGATCTTTTATTTCTTTAGACTTTACGTTCTATTTTTAAATTTAATTATTTTAAC
GTTGGTTTTACATAACCCTCCTATTTGTCGACCATTGATTTGCCATCCCATGCTTAGCTTTTACCTTTAATTTTTTTTCCAGTTTTTGTTTTTTTTTATC
TTTTTTTTTTTTCGCTTTCTATCTTCTTGTGGTTTGTTTTCTCTAATCTTTTAAAAACCTTGTGTTCTATTTTATTCTTATTTTATCTATTTTTCCTGCC
CTTATATCTTCCTTATCTATTTACATTTCTCCTATACTCCAGTCTTCTATCTCGCTTTTTGTCTTCTGTCTTTTCATAGTTTTCTTTTATTTTGTTTTTT
ACTTTTTTTTTT
>LE_HBa0048I16_SP6_63774 (trimmed for quality and cloning vector)
GGGGGAGTAACTAACTTATCTTTATTTAAAAAATTGATGGAAACTAGTTGCACATTACCCTAGGTCTCCATTCTCTCTTGCCAAAATGTGTGCAAGAATC
ATGAGCGGTTTAGGGGAAATTTTTGAATAAACTCATGACTAATTCAGCTATAGTGGCTCCGCCATAGCAGGACAACCCGATACAATGGTTTTGCTATAAT
GGGACCACCTGCTATAGTGGCTTCGCCATACCAGGAGCACTCACAATTGAAGGAACCAATTTCCCCCCTATAGCATCTTAACACCCCTATAGAGGCTTAC
ACAAAAAATAAACTCATAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952296
Expected error %
0.551116
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048I16
Clone
Clone name
hba-48i16
LE_HBa0048I16
P048I16
Clone type
BAC
Contamination
none
Estimated length
85,477
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found