Clone Read LE_HBa0048J04_T7_63799

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048J04_T7_63799
Primer
T7
ID from Seq. Facility
LE_HBa_048_J04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
671 trimmed for vector and quality, 792 raw
Genbank Accession
Sequence
>LE_HBa0048J04_T7_63799 (raw untrimmed)
CCCGGGACCCGGTGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGATTTTTCGTGTATCTTACCCTTTGGATCGTGGCGCCCTGTAGCACCAAA
AGAAATTCTCAAATATATTTATGAGGACCTCCATATTAAATTGGAGAACCATAAAGTATACGCACAATAGTTTTTAAACGTTTTTTCGCATTTACAAGAC
CTTTTTTAGGAATCACGCAAATTACTCAATTTTTCATTTGTATTAGCCCATGGATATGACGTCCTTGATCACTCAACCCAAATAAAAAATTCAATAAACT
TTATTAGGATCTCCTTAATGAGCTTGAAATCATCACGTGTACTCACATTATTTTTAATTGCCCATTTTCACATTTACATGCCTTTTTTAGGAATCATGTT
AATTCCTTAATTTTTTGTGTGTATTAGTCCATGAATCTAGTGCTCCAAAGCACTCTAAAAATTTGTGAGGGCCTTCTTAATGAAATGGTTACTCACACCA
TTTTTAAGCGCCTATTTTCAAATTTACAGGCCTTTTTTAAGAATCATACAAATTCTTCAATTTTTCATATCTATTAGCTTATGAAAATGGCGCCTCGAAG
CACCCAAAATATTTTTCTCAAAAACATTATGATGACCTCCGAAATTAGTTGGCGAACCTTCAATTATACTTATACCATTTTTTAAACGCTCATTTTCGCT
TGTATAACTTCTTTTTTGGAATCACATATATTTCTCAATTTCTCGTGTGTACAAGTCATGAATCTTGGCGCTTCAGAAAAACTCAAAAAAAA
>LE_HBa0048J04_T7_63799 (trimmed for quality and cloning vector)
AGCTTTGATTTTTCGTGTATCTTACCCTTTGGATCGTGGCGCCCTGTAGCACCAAAAGAAATTCTCAAATATATTTATGAGGACCTCCATATTAAATTGG
AGAACCATAAAGTATACGCACAATAGTTTTTAAACGTTTTTTCGCATTTACAAGACCTTTTTTAGGAATCACGCAAATTACTCAATTTTTCATTTGTATT
AGCCCATGGATATGACGTCCTTGATCACTCAACCCAAATAAAAAATTCAATAAACTTTATTAGGATCTCCTTAATGAGCTTGAAATCATCACGTGTACTC
ACATTATTTTTAATTGCCCATTTTCACATTTACATGCCTTTTTTAGGAATCATGTTAATTCCTTAATTTTTTGTGTGTATTAGTCCATGAATCTAGTGCT
CCAAAGCACTCTAAAAATTTGTGAGGGCCTTCTTAATGAAATGGTTACTCACACCATTTTTAAGCGCCTATTTTCAAATTTACAGGCCTTTTTTAAGAAT
CATACAAATTCTTCAATTTTTCATATCTATTAGCTTATGAAAATGGCGCCTCGAAGCACCCAAAATATTTTTCTCAAAAACATTATGATGACCTCCGAAA
TTAGTTGGCGAACCTTCAATTATACTTATACCATTTTTTAAACGCTCATTTTCGCTTGTATAACTTCTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.931597
Expected error %
0.464373
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048J04
Clone
Clone name
hba-48j4
LE_HBa0048J04
C02HBa0048J04
P048J04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found