Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

Clone Read LE_HBa0048K10_SP6_63858

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048K10_SP6_63858
Primer
SP6
ID from Seq. Facility
LE_HBa_048_K10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
5 trimmed for vector and quality, 842 raw
Sequence
>LE_HBa0048K10_SP6_63858 (raw untrimmed)
GGTATCCCTTTTTTGTCTTGTGTATTTATGTTATAATATGTTTATATGATATTATACACTATTCTTAATAGAAATATTACACTTAGTAGTATTTACTACG
AGATATACAATAATCTATAAATGGTATGAGAATGAAAGAGTAGCGGTAGAATAGAGAGATAGTTCTTGTAGCAATTTTGATGCAACGTTTCCTCAGAGGT
AGGGTAAAGGATGTTACAAAGAAGCATTAATAATACAACCAATTAGACTCCCTCCCTTGGTTTTTCCTAATTCTCTCCATGTTATATTTGATTGTCTTTG
TAGGTTTTCTCTAGATAGTTTATATCATTGTTATATTTGTCTAGGCTGTTGTTTGTATAATGTTATCCGTAGCCGGTTTATTATTACTTTATTATTATTT
TATTTTTGTTTTCTTTTTTCTTATTTCGTAGAATTATCTATGACATTTTTATGTGTGATGTGTATTGTATCTATGCTTTAACTGTACTCACTTTTTATAT
CGTTTTTACTTGTGTTAAACATCATACTTATTTATGATGCATCTCTCATTTCTCAAAATATAAATAAAAAGTAAGATATAAATTATGATTCTCGCGTTTT
GTTGTATCGTCTGTTTGTGTTCTCTATTGTTTTTTTTTCTAT
TTTTTTTTATACTTTGTTATTTTATTTCTTATTTAGCATATTTTAATATTATGTTTTT
ATATTTATATTCTATTTATTAGACGCTGTTGCTACTTCGTCTTTTTCTTTTAATTTTGTATTATTTTTTACTAATATTATTATTTTTGTTATTATTATAT
TTTATATTATTAACTTTTTTACCTCTTATTTTTTTAATTTTT
>LE_HBa0048K10_SP6_63858 (trimmed for quality and cloning vector)
TTTTT

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.57636
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048K10
Clone
Clone name
hba-48k10
LE_HBa0048K10
C02HBa0048K10
P048K10
Clone type
BAC
Contamination
none
Estimated length
122,298
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found