Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

Clone Read LE_HBa0048K10_T7_63859

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048K10_T7_63859
Primer
T7
ID from Seq. Facility
LE_HBa_048_K10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
250 trimmed for vector and quality, 905 raw
Genbank Accession
Sequence
>LE_HBa0048K10_T7_63859 (raw untrimmed)
CCTTGGCGCGGGGTTTTCACTAAAGAGCCGACCGGCAGGCATGCTAGCTTGGTGCTTTCCTCATCCCTCCCTTTTTTCTCGTTCAACTTTCTCTCTCTTC
CTCTTGTTCTTTCTATTTTCTTTATTCAAACCCACTTTCTTTTACCCTAATTAGTATATAATTAAGAATAAAAGATGGCAATAATACCCCACTAATTAAC
TTAGGGTTACCTCTTTTAACCCCCAAGAATTTGAGTTATTAATATAAACCCACTAACTTTATAATTAATGCAAGAATAGTCAAAAACGTCCCTTAAAACT
TAACCAGAAATCTGACTCCAACTGGGATTATGCAAACTGTGACGGGCCGTCGCGCCTGCGACGGTCCGTCCTGCTGTCCGTCGCATTTGATTTGTACTTG
ATTTTGGGTGAATGGACTGTGACGGACTATCACTATTGGTATTCTCCGATTCTATTATATGCGTTACGAATTTATTATACCAAAATATTTTATTTATTAT
CTATTTAATTTCTTGAAAAATTTTGTTTCATCTATTATCTATTTTAATTGTTTTTTCTTTTATGTATGCTTGTGTTTTTGTTTGTTCTTGTATATGCTCT
TTTATTTACTTTATCTTTATTTATTGTACTTAATCCTACTCAGTTTTTATTTTATTTTTTTGTATTATTTTTATTTTTTTTTATTTAATTTTTCTTATCT
TTTTTTTTTGATGTGGATATGATGTGAATTGATTATGTATTTTATTTTCTATTTTTGGCTCATTACTCTTTTTTTTTCGTCTTATCATTTTATTATTGTT
TGGGGGGGGGGGGGGTGGGTTGGGATTGGTGGGTAAGTGGTAAGCGTCAGTATACTTTTTACATTTTTATTCTATCTTTATATCTACTTTTATTTCTCTT
TTATA
>LE_HBa0048K10_T7_63859 (trimmed for quality and cloning vector)
CAACTTTCTCTCTCTTCCTCTTGTTCTTTCTATTTTCTTTATTCAAACCCACTTTCTTTTACCCTAATTAGTATATAATTAAGAATAAAAGATGGCAATA
ATACCCCACTAATTAACTTAGGGTTACCTCTTTTAACCCCCAAGAATTTGAGTTATTAATATAAACCCACTAACTTTATAATTAATGCAAGAATAGTCAA
AAACGTCCCTTAAAACTTAACCAGAAATCTGACTCCAACTGGGATTATGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.897067
Expected error %
0.559762
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048K10
Clone
Clone name
hba-48k10
LE_HBa0048K10
C02HBa0048K10
P048K10
Clone type
BAC
Contamination
none
Estimated length
122,298
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found