Clone Read LE_HBa0012N11_SP6_6404

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0012N11_SP6_6404
Primer
SP6
ID from Seq. Facility
LE_HBa_012_N11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
487 trimmed for vector and quality, 928 raw
Sequence
>LE_HBa0012N11_SP6_6404 (raw untrimmed)
AAAGGATTCNCTTAAGGTATAGGANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNTCCTTTAAGGAANNNANAA
ANNANNNAANNNNNAAAANNNNNCCTTTAAGTAANNTTTAAAAATATNANNNCTATGTNATAATNNNTATGGTTNAN
ATTAAATGATTTTNTAANTTTTT
TAAATTTTGTGTTATNTAGTTAAGNAATTGTNNNTNTTATAAAGTAATAATATTAAATTATTTTNTTAATAAGAGTGTNAAAATTTANAAATTAAAAGAA
ATATATTATTTTTNTTAAATATAATTTAAANANAGTTANATAAATTGAAANATANGAAATAATANTTAATATTTTGTNANATAGATTAANTTAGGAATTN
ATATGGAGTTANATATTGAAAAATTTTAATTTTTTTTTATTGTTTTTANAGGATTTGGAAGTGAATATTTTNANATTTNTGAGATAAAAAGTGTTGAAGG
TAANAAAAATAATGAAAAAGGATTTAATGAAGTTTTATTAAGTATTATTGGTTGTAAGGGNAATGAAGAATTTTTGGTAAGTAAATTATATTATAATTAT
GATAATTTTAAATTTTTAAAAAGAAAGTAATAATTTTTTATTATTAGTTAAAATTTTTTTTTTATTGGATTAAAAAAAAAAGGTTATTATTATTTGAGTA
TTTATTATTTTTGTATATATGAAGAGAATATTTTTTTGTTTTTGTTAAAAAAATAAATTTTGTAAAAAGTTGAATGAAAGTTAATTTTATAAGAATTTTT
AGAATTTTTGAATTTTATTTTATTAAAGGAATATAAAAAAAAATTTTAATTTAATAAAAGAAATTTTATTTAAAAAAAATTTGATTTGGAAAATTTTTTA
AAAATTAAAATTATTTATGGGAAAAATG
>LE_HBa0012N11_SP6_6404 (trimmed for quality and cloning vector)
ATTAAATGATTTTNTAANTTTTTTAAATTTTGTGTTATNTAGTTAAGNAATTGTNNNTNTTATAAAGTAATAATATTAAATTATTTTNTTAATAAGAGTG
TNAAAATTTANAAATTAAAAGAAATATATTATTTTTNTTAAATATAATTTAAANANAGTTANATAAATTGAAANATANGAAATAATANTTAATATTTTGT
NANATAGATTAANTTAGGAATTNATATGGAGTTANATATTGAAAAATTTTAATTTTTTTTTATTGTTTTTANAGGATTTGGAAGTGAATATTTTNANATT
TNTGAGATAAAAAGTGTTGAAGGTAANAAAAATAATGAAAAAGGATTTAATGAAGTTTTATTAAGTATTATTGGTTGTAAGGGNAATGAAGAATTTTTGG
TAAGTAAATTATATTATAATTATGATAATTTTAAATTTTTAAAAAGAAAGTAATAATTTTTTATTATTAGTTAAAATTTTTTTTTTA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.810661
Expected error %
12.2611
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0012N11
Clone
Clone name
hba-12n11
LE_HBa0012N11
P012N11
Clone type
BAC
Contamination
none
Estimated length
136,026
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found