Clone Read LE_HBa0048O11_T7_64053

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0048O11_T7_64053
Primer
T7
ID from Seq. Facility
LE_HBa_048_O11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
623 trimmed for vector and quality, 845 raw
Genbank Accession
Sequence
>LE_HBa0048O11_T7_64053 (raw untrimmed)
TTGGGTTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTACATGAAAGTGAACAATTGCATAAGAAAAAGAGAAGGAAAGATTGCAT
GAGTAGGTTATACAAGTAGAGGAAGTGTCAAGTATAGAAGATCTAATTTGTACATCAGACAGGATCGAAAGTCTACCTATTCTTGTCAACCTAAGTTCGA
TCAAGCTCTTAAGGAAATCCTTGAAACTCAAGGGGACTGGACTAGACACCACATCGGTGATCCGAACTAGTATAAAAATTTCAGTGTTCATTTTACTTTT
GTTATATTTTACTGAACTAACCTGCAGAGAAGTTGGCTACGGCACTCAGGCAGTCGACTGAACAACTATTTTTAATTCAACCCCCCCTCTTATCTTTCAA
TTGGTATCAGAGCAGGTTTCACAGATTAAGTGTTTAACTAAACGTTAGCAAATATAAAATGACACACTACCGAATCCCCGACGCATTACTCCAGGATAGA
CACTCATCACATCAACCACCTTACTTTAATGGGCAATACTATTTTCACTGGAAGGACAAATTTATAATCTTCGTTCTCCTTCAACAACCATAAAGCATGG
ATAGTTATCAAGAAAGATTTCAAAGCCTTATTCTTGGATTAACTTGAAAATGGATGGTACTGAGAAACCGTTTCTATGCTGAATGATTCGATTTTACCTA
ATGAACAACGATGAGGTAATTCATACTATTCTCTTGATTTTTAAGTTTTGGTTTGACTGGTGTAGTGAGTGGAAGTTATAATTGGAATATGGTATTAGCT
TTTGTTAAGCATTCTATATAAAGTTGCGGGGGTTTAATTTGTAAG
>LE_HBa0048O11_T7_64053 (trimmed for quality and cloning vector)
AGCTTTGTACATGAAAGTGAACAATTGCATAAGAAAAAGAGAAGGAAAGATTGCATGAGTAGGTTATACAAGTAGAGGAAGTGTCAAGTATAGAAGATCT
AATTTGTACATCAGACAGGATCGAAAGTCTACCTATTCTTGTCAACCTAAGTTCGATCAAGCTCTTAAGGAAATCCTTGAAACTCAAGGGGACTGGACTA
GACACCACATCGGTGATCCGAACTAGTATAAAAATTTCAGTGTTCATTTTACTTTTGTTATATTTTACTGAACTAACCTGCAGAGAAGTTGGCTACGGCA
CTCAGGCAGTCGACTGAACAACTATTTTTAATTCAACCCCCCCTCTTATCTTTCAATTGGTATCAGAGCAGGTTTCACAGATTAAGTGTTTAACTAAACG
TTAGCAAATATAAAATGACACACTACCGAATCCCCGACGCATTACTCCAGGATAGACACTCATCACATCAACCACCTTACTTTAATGGGCAATACTATTT
TCACTGGAAGGACAAATTTATAATCTTCGTTCTCCTTCAACAACCATAAAGCATGGATAGTTATCAAGAAAGATTTCAAAGCCTTATTCTTGGATTAACT
TGAAAATGGATGGTACTGAGAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962408
Expected error %
1.79976
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0048O11
Clone
Clone name
hba-48o11
LE_HBa0048O11
P048O11
Clone type
BAC
Contamination
none
Estimated length
115,089
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found