Clone Read LE_HBa0130B18_SP6_64210

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0130B18_SP6_64210
Primer
SP6
ID from Seq. Facility
LE_HBa_130_B18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
651 trimmed for vector and quality, 991 raw
Genbank Accession
Sequence
>LE_HBa0130B18_SP6_64210 (raw untrimmed)
GGAGGGTTTTCACAACTGGATCTAGTTCAAAGCAGACTGATCGATTAGATATGTCAAAATTGAAACAATTCCATAATTTAGATCATTAACAAGAAGATAT
CAAACTAAAACGGTTAGTGAAATAATTTCAGAATTCAGATCAAAATCACCCTTCGTAACATACTATACATGTAAAGTTTTGTACTAAAATGAATCTGAAA
ATTAGTATCGTAACCTATTTTCATCTCGGGATTACCTTCGTTCCCCATATTATCATAGACAAGTTGAAAATTTCTCGATCAATAGGTCGATCCATTCGGG
GATCATCTCCTAGCTGTTCCCTAACATCATTGAAATTTTTACAGAGTGCTATGATTTTTTCTTCTAAAGCCTCTCTGGACATTTTCAAATCAGGGAATGA
ATCCTTGACGTAAACGAGTCGATTATTAAATGAGGAAAGTTGAGGAGAATTTCTAATAATGCACTCGTAATCACACATGGCTTTTAAAATCGCCAAATCC
AGATGATGATCCTCGTCTTCGTCGTGTAATTCAGTAATTGATATTCCTCCTCCATCACTCATTGGTTGTTTTCCTTTTTCAGCAGCTCTTCTTCTTTCTT
CTTCTTCGTCTTCGTCGTCTTCTACTACTACTAACCAAGATGTATGATTTTCATCATATGATTCTTGATTTCCACTTCCATTTTCTTCAGAATTTTGATG
ATTCACATTGTTTCCCGATCCTAAATTCTCCCTATCTTCTTCTTCTTCATAATCGTCAATGCGAACTTCATCTGTTTCTCCCAATTGATTCCCTCCAGCT
TCCTCTGTTTTTCTCTGTTTTGAATTTCAATTTTCCTTTATGCCCTCCTCCTTTTCCTCGGTACGTCCAATTGCAGGGAAATTTTTTTTAAAATTTTTGT
AAAGAGAAAAAAAGAAAAAGAATTTTTCCTTTCTTTTTTTTAATTGAGAGGATGAAAAAAATAAACTCCCCTTTTTTAATAAAAATAATAT
>LE_HBa0130B18_SP6_64210 (trimmed for quality and cloning vector)
CTAGTTCAAAGCAGACTGATCGATTAGATATGTCAAAATTGAAACAATTCCATAATTTAGATCATTAACAAGAAGATATCAAACTAAAACGGTTAGTGAA
ATAATTTCAGAATTCAGATCAAAATCACCCTTCGTAACATACTATACATGTAAAGTTTTGTACTAAAATGAATCTGAAAATTAGTATCGTAACCTATTTT
CATCTCGGGATTACCTTCGTTCCCCATATTATCATAGACAAGTTGAAAATTTCTCGATCAATAGGTCGATCCATTCGGGGATCATCTCCTAGCTGTTCCC
TAACATCATTGAAATTTTTACAGAGTGCTATGATTTTTTCTTCTAAAGCCTCTCTGGACATTTTCAAATCAGGGAATGAATCCTTGACGTAAACGAGTCG
ATTATTAAATGAGGAAAGTTGAGGAGAATTTCTAATAATGCACTCGTAATCACACATGGCTTTTAAAATCGCCAAATCCAGATGATGATCCTCGTCTTCG
TCGTGTAATTCAGTAATTGATATTCCTCCTCCATCACTCATTGGTTGTTTTCCTTTTTCAGCAGCTCTTCTTCTTTCTTCTTCTTCGTCTTCGTCGTCTT
CTACTACTACTAACCAAGATGTATGATTTTCATCATATGATTCTTGATTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944806
Expected error %
0.136152
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0130B18
Clone
Clone name
hba-130b18
LE_HBa0130B18
C07HBa0130B18
P130B18
Clone type
BAC
Contamination
none
Estimated length
59,377
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found