Clone Read LE_HBa0130B18_T7_64211

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0130B18_T7_64211
Primer
T7
ID from Seq. Facility
LE_HBa_130_B18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
795 trimmed for vector and quality, 843 raw
Genbank Accession
Sequence
>LE_HBa0130B18_T7_64211 (raw untrimmed)
CTTAACTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTTATGTATAGAATCTCGAGCACTTCAGAATGAAGAAATATATTGT
GAAAAATGAAGTTCTAAATAAGATGCAAAAATTACCTAAGTTACTTAGTTGACTGATTGCTCCTGCGCCAATTTTATTTTCTAACTTAAGTACCCGCAGA
ATTCCAGCGGCAATCCGACCCATGGAGTCAACCTCAGACTTGCACAAGAAAGCAAGATACTTGAGCTCAGCCTTAGTCACTACTGCCTCGATCTGCCAAA
TACACAAACTTCTTTATTACACAAAGCAGGGAGATAGAAATCAAAGGACAAACTTGCAAAATTTTTGTACCGGCTGTTTGACAGAAAATTTCAAATTTTC
GACAATCCACTTTCCCAATCCATCATCAATATCGTCTTCGCAATTCACTATGTCTACTTCGATGTTCATACCACCAAATCTCTCAGCAGTCTCTTTAAGA
GGTCCTTCAGGACTATCTTGCCTGATACTATGTGGAGAACGTGGTTTTAAGATCTGCAGACCTTCCACACCAACCTGCAGCAGCTCCTAGTTAGGTTACT
TGTCTTAAAAATCTCCATGAAAAGAAAAAAAGTTACAAGTAAGTGAGCAAAAGTGACAATAACTGCAAGGCCTCAATCCCAATCAAGTTGGGATCGACTA
TATGAATACTGACCATGTTGCTCCATTTAAACACATCTCAGGCCATTATTAAAACAAGAGAACAAAGAAACTAGTTATTTGCATAAAGACTAAGGTTAGT
GCATATTTATCTGTTTTAAGCTATAAAGATAGATGGAAAAACA
>LE_HBa0130B18_T7_64211 (trimmed for quality and cloning vector)
AGCTTGTTTATGTATAGAATCTCGAGCACTTCAGAATGAAGAAATATATTGTGAAAAATGAAGTTCTAAATAAGATGCAAAAATTACCTAAGTTACTTAG
TTGACTGATTGCTCCTGCGCCAATTTTATTTTCTAACTTAAGTACCCGCAGAATTCCAGCGGCAATCCGACCCATGGAGTCAACCTCAGACTTGCACAAG
AAAGCAAGATACTTGAGCTCAGCCTTAGTCACTACTGCCTCGATCTGCCAAATACACAAACTTCTTTATTACACAAAGCAGGGAGATAGAAATCAAAGGA
CAAACTTGCAAAATTTTTGTACCGGCTGTTTGACAGAAAATTTCAAATTTTCGACAATCCACTTTCCCAATCCATCATCAATATCGTCTTCGCAATTCAC
TATGTCTACTTCGATGTTCATACCACCAAATCTCTCAGCAGTCTCTTTAAGAGGTCCTTCAGGACTATCTTGCCTGATACTATGTGGAGAACGTGGTTTT
AAGATCTGCAGACCTTCCACACCAACCTGCAGCAGCTCCTAGTTAGGTTACTTGTCTTAAAAATCTCCATGAAAAGAAAAAAAGTTACAAGTAAGTGAGC
AAAAGTGACAATAACTGCAAGGCCTCAATCCCAATCAAGTTGGGATCGACTATATGAATACTGACCATGTTGCTCCATTTAAACACATCTCAGGCCATTA
TTAAAACAAGAGAACAAAGAAACTAGTTATTTGCATAAAGACTAAGGTTAGTGCATATTTATCTGTTTTAAGCTATAAAGATAGATGGAAAAACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964556
Expected error %
0.198071
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g20720.1 Score 113 E Value 1e-25 Identity 16.00% Align. Length 443bp (55.72%) Frame 3
68416.m02622 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB02479.1| Score 113 E Value 7e-24 Identity 16.00% Align. Length 443bp (55.72%) Frame 3
unnamed protein product [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_188708.1| Score 113 E Value 7e-24 Identity 16.00% Align. Length 443bp (55.72%) Frame 3
expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0130B18
Clone
Clone name
hba-130b18
LE_HBa0130B18
C07HBa0130B18
P130B18
Clone type
BAC
Contamination
none
Estimated length
59,377
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found