Clone Read LE_HBa0130C08_SP6_64238

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0130C08_SP6_64238
Primer
SP6
ID from Seq. Facility
LE_HBa_130_C08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
258 trimmed for vector and quality, 900 raw
Genbank Accession
Sequence
>LE_HBa0130C08_SP6_64238 (raw untrimmed)
CCAGTGTTTGTGATATTGGTGTGAGTTCTGCCTAAGTTCCTAAGCTATNGGTAGTAGAATTTCCTTAGATCGACACTAGATCGTTATGGGTCCAGTTATA
GGT
GGTGGTGCTTACCTTTCCATATATATATATATTTATGTTATGATCATGACCTTGAAGTCAAATTAATTTTTGGTGAAGTTTGATTATGATGACCACA
CACATGAGGTTGTTTGCTTGGTATTATAATCTAGTATCATGTTCTAGGTGTATTGATTATGTTTTCTATATGTGAATAAGGTTGTTAAGGTTATGTGGTC
TACATGTTTATCATTGATAAAGTATATTGATGAATGAACCCTACCTATGAACCCCTACATAAATGTGTGTTCTTTAACATGATTAGAAGTCTAGATTCCA
AATGAAGATGTCTTGGCTCCTATTTTATAATGCTGTTGTGTGGGGGATATAAGTCCTATTACTCCATATGTGAGTGGACTATTGTTGTGAGGGAATGAAT
GGGTATTTTGACGTTGTCAAAGGGCTGGCTCCAGATGAGATTTGTTGCCATAATGGATCTATTAACAATGTGCACACCACTCGTGGATGACTATAAATAG
AATACTCCAAAAAAGATCAAATATATGTTCGGATCCACTACATGTGCTCCTATTGTAAAAAAAATATCTTGCTTATAATTAGTTTTATTAGGATGTTAAA
GTTGGCATATAACAAAATCGGAGCTAATAACCGGCCCAGTGGGGCGAAAGACTCCAGGTCACACATGTTTCACCTTAGCCCTTCATTTATTCAAAAAAAA
TCTCTAATGCTGGCATCCATACGAGACATGACGGTGACTCACAATCTTTATATATATTCTATGTGGTGGTGTATGTTTAGATGTAATACACTCAATTGAA

>LE_HBa0130C08_SP6_64238 (trimmed for quality and cloning vector)
GGTGGTGCTTACCTTTCCATATATATATATATTTATGTTATGATCATGACCTTGAAGTCAAATTAATTTTTGGTGAAGTTTGATTATGATGACCACACAC
ATGAGGTTGTTTGCTTGGTATTATAATCTAGTATCATGTTCTAGGTGTATTGATTATGTTTTCTATATGTGAATAAGGTTGTTAAGGTTATGTGGTCTAC
ATGTTTATCATTGATAAAGTATATTGATGAATGAACCCTACCTATGAACCCCTACATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.885274
Expected error %
0.0670126
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0130C08
Clone
Clone name
hba-130c8
LE_HBa0130C08
P130C08
Clone type
BAC
Contamination
none
Estimated length
95,422
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found