Clone Read LE_HBa0130C08_T7_64239

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0130C08_T7_64239
Primer
T7
ID from Seq. Facility
LE_HBa_130_C08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
657 trimmed for vector and quality, 883 raw
Genbank Accession
Sequence
>LE_HBa0130C08_T7_64239 (raw untrimmed)
AATAACCCGGGTCCCGGGGNAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAAGATTCAGAATCAGGAAACCGTTTGAGACCCTTTCGCTCTTTTT
ATATTTGTTTTGATGCTCTTAAAAGGGGTTTTCAACAAGGATGCAGAAGATGTATAGGGCTGGATGGGTGTTTTCTAAAGGGAATTTGTAGGGCTCAACT
TTTGGTAGCTGTTGCTAAATATGCGAACAACCAAATGTATCCAATAACATGGGCAGTAATTGATACTGAAAGCAAGTTGACATAGAAATGGTTCATGATC
ATTCTGAAAGATGATCTTAATCTAGGAAATGGTTCCCAGCTAACTATCATTAGTGATATGCAAAACGTAATTGAATATCTTTCTTTAGATCAAGAGCATT
TGCTGAAACATGGACAGATGGAATATTTCCAATGGCAATGATGGTATTCAATACAAATGTAACAAGATCAATGCAGTGCAACATTGAATGGAATGGTGAT
GTTGGATTTGAAGTGTTAGAAGGGGTATACAAGCATACTGCGAACTTGGGTCAACAAAAATGTAGTTGCAGATCATGGGAATTAAAAGGTATCCCATGTG
CACAAGCTATAGCAGCAATGAACCCCTTGAACATGGATGCCTCACAAGCAATATCTAGTTGGTATAGAAATCACACATATATGAAGACATATTCCTCTTT
CATTCAACCAGTCCCTAACATGGAAATCTGGCCTGAAAGTTAAAACCCCATTGGTTGAACTTCCTGACGCAAGACAAATTGCCTGCTACGCCCCCAATCA
CTATAAGAGAAGAAAATGGCTGAAGTGAGAAAACTTGAAAAATTCACCTATATGGGGATCAATTATGATATGTTCACCTTCTT
>LE_HBa0130C08_T7_64239 (trimmed for quality and cloning vector)
AGCTTAAAGATTCAGAATCAGGAAACCGTTTGAGACCCTTTCGCTCTTTTTATATTTGTTTTGATGCTCTTAAAAGGGGTTTTCAACAAGGATGCAGAAG
ATGTATAGGGCTGGATGGGTGTTTTCTAAAGGGAATTTGTAGGGCTCAACTTTTGGTAGCTGTTGCTAAATATGCGAACAACCAAATGTATCCAATAACA
TGGGCAGTAATTGATACTGAAAGCAAGTTGACATAGAAATGGTTCATGATCATTCTGAAAGATGATCTTAATCTAGGAAATGGTTCCCAGCTAACTATCA
TTAGTGATATGCAAAACGTAATTGAATATCTTTCTTTAGATCAAGAGCATTTGCTGAAACATGGACAGATGGAATATTTCCAATGGCAATGATGGTATTC
AATACAAATGTAACAAGATCAATGCAGTGCAACATTGAATGGAATGGTGATGTTGGATTTGAAGTGTTAGAAGGGGTATACAAGCATACTGCGAACTTGG
GTCAACAAAAATGTAGTTGCAGATCATGGGAATTAAAAGGTATCCCATGTGCACAAGCTATAGCAGCAATGAACCCCTTGAACATGGATGCCTCACAAGC
AATATCTAGTTGGTATAGAAATCACACATATATGAAGACATATTCCTCTTTCATTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95726
Expected error %
1.39837
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g14570.1 Score 81 E Value 6e-16 Identity 15.30% Align. Length 287bp (43.68%) Frame 1
68415.m01632 SWIM zinc finger family protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAW28576.1| Score 121 E Value 2e-26 Identity 18.30% Align. Length 305bp (46.42%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU43947.1| Score 109 E Value 7e-23 Identity 18.10% Align. Length 275bp (41.86%) Frame 1
hypothetical protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0130C08
Clone
Clone name
hba-130c8
LE_HBa0130C08
P130C08
Clone type
BAC
Contamination
none
Estimated length
95,422
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found