Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0130G02_T7_64419

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0130G02_T7_64419
Primer
T7
ID from Seq. Facility
LE_HBa_130_G02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
739 trimmed for vector and quality, 805 raw
Genbank Accession
Sequence
>LE_HBa0130G02_T7_64419 (raw untrimmed)
TCTAACCCGGGCCCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACGCCACAATTCCGTTCCCCCCTATAGGGCCCCGCATGCATACCAG
AGAGGGAAAAAAAAACTTTAGGGGACAATCATGTTAAAAAGCAGGCCATAAGTACCTAACATAATCATCAAATACAACTTGTCTCCAATATCTATTTAAA
CAACAGAACAGAACCACTCTGCTACGGACAAGAACAAGTAAACATAAAAAATTAGGAAAAGGAAAAGAAAATAACGAACATCACAAAAAAGCAGAAACTC
AACAAGTAAAAATATTTACTAAATATATACAAACAATTCAAAAAGTTGACTACTGAGACAATTAAAATTGGCAACATTAAAATATTAGTCCTAAAAATGT
TTTAAGTTAATTAAGAAAAGTTAATTGGCATACCTCCAATTGAATAAGCCAACTGTTTGCCCCAGACCCATAACCTCTATGGATATGGTAACCTGGTAGT
GTTCCATCCAGACACACTGTAGAAAAAAGTTTAAACAAAAAAGTCAAAAACAACTTAATCACTTTTTCAGAAATAATTTTTAAAATTGCAAAACCTTATT
AAGCTAATTAGCCAGAGCGAGAGAATTAAGCAAATCTCTTCATCAACCACTTGGCCTTATCATTCTCACACAGATCACAAATAAAACACATTACAAGTTG
TTGTCAAATTTGGCTAATTCTGTAAGCAACTTGTTAAAATTTGTTGACAAGAGTCAATTATGAGTGGACTAGATTAATTAGTTTTTTTAATATAGAAATT
CAATA
>LE_HBa0130G02_T7_64419 (trimmed for quality and cloning vector)
AGCTTCACGCCACAATTCCGTTCCCCCCTATAGGGCCCCGCATGCATACCAGAGAGGGAAAAAAAAACTTTAGGGGACAATCATGTTAAAAAGCAGGCCA
TAAGTACCTAACATAATCATCAAATACAACTTGTCTCCAATATCTATTTAAACAACAGAACAGAACCACTCTGCTACGGACAAGAACAAGTAAACATAAA
AAATTAGGAAAAGGAAAAGAAAATAACGAACATCACAAAAAAGCAGAAACTCAACAAGTAAAAATATTTACTAAATATATACAAACAATTCAAAAAGTTG
ACTACTGAGACAATTAAAATTGGCAACATTAAAATATTAGTCCTAAAAATGTTTTAAGTTAATTAAGAAAAGTTAATTGGCATACCTCCAATTGAATAAG
CCAACTGTTTGCCCCAGACCCATAACCTCTATGGATATGGTAACCTGGTAGTGTTCCATCCAGACACACTGTAGAAAAAAGTTTAAACAAAAAAGTCAAA
AACAACTTAATCACTTTTTCAGAAATAATTTTTAAAATTGCAAAACCTTATTAAGCTAATTAGCCAGAGCGAGAGAATTAAGCAAATCTCTTCATCAACC
ACTTGGCCTTATCATTCTCACACAGATCACAAATAAAACACATTACAAGTTGTTGTCAAATTTGGCTAATTCTGTAAGCAACTTGTTAAAATTTGTTGAC
AAGAGTCAATTATGAGTGGACTAGATTAATTAGTTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.926867
Expected error %
0.616183
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0130G02
Clone
Clone name
hba-130g2
LE_HBa0130G02
P130G02
Clone type
BAC
Contamination
none
Estimated length
127,003
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found