Clone Read LE_HBa0130N01_T7_64753

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0130N01_T7_64753
Primer
T7
ID from Seq. Facility
LE_HBa_130_N01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
764 trimmed for vector and quality, 835 raw
Genbank Accession
Sequence
>LE_HBa0130N01_T7_64753 (raw untrimmed)
ACTAACCCGGGACCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCAATAACAGATGACCCTCCCTTTAGTGACTCTCAACGTGAAGTC
TTTCTCCTCAGAGCTCCCTTATCCTCCTCTGCTCTTTTTCTCTCAAACCTAGCCAAGTAAAGCGAAGATCATATAATAAAGGAACATATGACAGTATTGG
TTTAAGATAAATTCATAATGGGTATACAGACAAAGGTTAACCTTCAGTTACCTTTCTTTCTCTAGTTCTATCTGCAACTGTGCAAGATCAACTCGAACTT
CGTCGATCTTGGATTGCCATTCTTCCAGCGTCTCCCGCAATTGCTGGGAAGATTTTCTTACATCTAAAAACCGTTTTTGGGTGTTCTCTAAAGCAAGAGA
ATTCTGACCCCTATCTTCAGCAAGCTTCTGGATCAAGTCTGAGCATCCCCTCAACTGAAAGGAAATACATACACTTAAAGTCTGGAGAAATATAAACATT
TGGCACTTCAGAGAAGATATGCAATTACCTGGTCATCAATTTTGGCAGCTTTCATTTCATAGGAACTGACCATTGTATTGGCATCTTCAACTGCTCTCTC
TGTGATTTGACTTTCCCAAGCCAAACAATCCCGCTGTTGTCTTGCCCGTACTCCTTCTAAAACAAGCTGTAGAACAGGAAATAAACTAACCACAGTGTAC
AACATTGGCAGCAGTAGAAACCTGAGACACTAGAAATGCACAGACAGAACGTTTTTTGGAGTACTCTTGAAGCGATGTAAGGAAATTTGTGGATGCGAAA
CTCTAAAAACCCAACATATCCATGTTAAGCTACAG
>LE_HBa0130N01_T7_64753 (trimmed for quality and cloning vector)
AGCTTCTCAATAACAGATGACCCTCCCTTTAGTGACTCTCAACGTGAAGTCTTTCTCCTCAGAGCTCCCTTATCCTCCTCTGCTCTTTTTCTCTCAAACC
TAGCCAAGTAAAGCGAAGATCATATAATAAAGGAACATATGACAGTATTGGTTTAAGATAAATTCATAATGGGTATACAGACAAAGGTTAACCTTCAGTT
ACCTTTCTTTCTCTAGTTCTATCTGCAACTGTGCAAGATCAACTCGAACTTCGTCGATCTTGGATTGCCATTCTTCCAGCGTCTCCCGCAATTGCTGGGA
AGATTTTCTTACATCTAAAAACCGTTTTTGGGTGTTCTCTAAAGCAAGAGAATTCTGACCCCTATCTTCAGCAAGCTTCTGGATCAAGTCTGAGCATCCC
CTCAACTGAAAGGAAATACATACACTTAAAGTCTGGAGAAATATAAACATTTGGCACTTCAGAGAAGATATGCAATTACCTGGTCATCAATTTTGGCAGC
TTTCATTTCATAGGAACTGACCATTGTATTGGCATCTTCAACTGCTCTCTCTGTGATTTGACTTTCCCAAGCCAAACAATCCCGCTGTTGTCTTGCCCGT
ACTCCTTCTAAAACAAGCTGTAGAACAGGAAATAAACTAACCACAGTGTACAACATTGGCAGCAGTAGAAACCTGAGACACTAGAAATGCACAGACAGAA
CGTTTTTTGGAGTACTCTTGAAGCGATGTAAGGAAATTTGTGGATGCGAAACTCTAAAAACCCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966868
Expected error %
0.545875
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g44950.1 Score 71 E Value 1e-16 Identity 47.50% Align. Length 438bp (57.33%) Frame 1
68415.m05596 zinc finger (C3HC4-type RING finger) family protein contains Pfam profile: PF00097 zinc finger, C3HC4 type (RING finger)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ56803.1| Score 71 E Value 5e-15 Identity 47.50% Align. Length 438bp (57.33%) Frame 1
At2g44950 [Arabidopsis thaliana] gb|AAL91211.1| unknown protein [Arabidopsis thaliana] ref|NP_182022.2| zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM14834.1| Score 71 E Value 5e-15 Identity 47.50% Align. Length 438bp (57.33%) Frame 1
unknown protein [Arabidopsis thaliana] gb|AAD32840.1| unknown protein [Arabidopsis thaliana] pir||T00398 hypothetical protein At2g44950 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0130N01
Clone
Clone name
hba-130n1
LE_HBa0130N01
P130N01
Clone type
BAC
Contamination
none
Estimated length
77,055
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found