Clone Read LE_HBa0033A13_T7_6553

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0033A13_T7_6553
Primer
T7
ID from Seq. Facility
LE_HBa_033_A13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
886 trimmed for vector and quality, 933 raw
Genbank Accession
Sequence
>LE_HBa0033A13_T7_6553 (raw untrimmed)
GCTGACTCGGTACCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTATTGATGAAGTTTTACTCATTATCATCTGGCGTTGTCAATCATTT
GCTCTCTGATCAGCATGGTGAAGCATTAGATCTCCCTTTTGAAGTTACTAATGAAGAGAGGGAGATAATCCAATTTAGTAGAAGTAGTTTCATCCTCGGT
CGCTCAGGCACGGGTAAAACCACAGTTTTGACCATGAAGTTATTGCAAAAGGAGCAACAGCATCACAATTCTGTTGAAGGATTAAATAAAGCAGGGAAAG
AAGTACATCGATTCAAAGGGCAAGCAGATGAGGATAATCAATGTGTAGAGGAGGCTAGCAGGGAAACCCTTCGCCAACTTTTCGTGACTGTTAGTCCGAA
ACTTTGTTATGCTGTCAAACAGCAGATTTCTCAGTTGAAAAGGTAAGTACCAATCTTCTTGTGAGTTTACTGGAGCTGCTTGCTGTAATGTCGGCTAGTT
ACATGTCAGGTGTTAGTTCATTTATCCTATCTGAATTATACATACTCGTAATATTCCAAGGCATAAGCATGATGCAGTGCTACCTTTTACTTTTTGAACA
TCTTCTACTTCTTGACCTTCCTAAATCTTTTATTGTAATAAAGAAATTTACAACCTAGAAAAGTCCGTGTTCTCAACCTTTACCACCACTTAATCTTTGC
ATTTCCGAATTACTCTCATCCGTATATAAACAAGTTGTTAGCGGAAACGTGAAACTAAAGAACAAGGAAAAACAACAATATTTAACGTGGTTCGGATCAA
AATGAACCTATGTCCACCAAAGAACAACTGCACCAATATTTATTCCACTCTACAAAGAATACAAGTGAAATACTATAAGAGAGAGAACACAATGCCATAG
AAGGTGAGAAGGGCAGTGAGAGGATGATTTAAA
>LE_HBa0033A13_T7_6553 (trimmed for quality and cloning vector)
AGCTTGTTATTGATGAAGTTTTACTCATTATCATCTGGCGTTGTCAATCATTTGCTCTCTGATCAGCATGGTGAAGCATTAGATCTCCCTTTTGAAGTTA
CTAATGAAGAGAGGGAGATAATCCAATTTAGTAGAAGTAGTTTCATCCTCGGTCGCTCAGGCACGGGTAAAACCACAGTTTTGACCATGAAGTTATTGCA
AAAGGAGCAACAGCATCACAATTCTGTTGAAGGATTAAATAAAGCAGGGAAAGAAGTACATCGATTCAAAGGGCAAGCAGATGAGGATAATCAATGTGTA
GAGGAGGCTAGCAGGGAAACCCTTCGCCAACTTTTCGTGACTGTTAGTCCGAAACTTTGTTATGCTGTCAAACAGCAGATTTCTCAGTTGAAAAGGTAAG
TACCAATCTTCTTGTGAGTTTACTGGAGCTGCTTGCTGTAATGTCGGCTAGTTACATGTCAGGTGTTAGTTCATTTATCCTATCTGAATTATACATACTC
GTAATATTCCAAGGCATAAGCATGATGCAGTGCTACCTTTTACTTTTTGAACATCTTCTACTTCTTGACCTTCCTAAATCTTTTATTGTAATAAAGAAAT
TTACAACCTAGAAAAGTCCGTGTTCTCAACCTTTACCACCACTTAATCTTTGCATTTCCGAATTACTCTCATCCGTATATAAACAAGTTGTTAGCGGAAA
CGTGAAACTAAAGAACAAGGAAAAACAACAATATTTAACGTGGTTCGGATCAAAATGAACCTATGTCCACCAAAGAACAACTGCACCAATATTTATTCCA
CTCTACAAAGAATACAAGTGAAATACTATAAGAGAGAGAACACAATGCCATAGAAGGTGAGAAGGGCAGTGAGAGGATGATTTAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.971823
Expected error %
0.421759
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE03468.1| Score 122 E Value 1e-26 Identity 17.70% Align. Length 395bp (44.58%) Frame 2
OSJNBa0083N12.5 [Oryza sativa (japonica cultivar-group)] ref|XP_473751.1| OSJNBa0083N12.5 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0033A13
Clone
Clone name
hba-33a13
LE_HBa0033A13
C12HBa0033A13
P033A13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found