Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0186L05_T7_66201

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0186L05_T7_66201
Primer
T7
ID from Seq. Facility
LE_HBa_186_L05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
659 trimmed for vector and quality, 826 raw
Genbank Accession
Sequence
>LE_HBa0186L05_T7_66201 (raw untrimmed)
TGGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCATTGCTTGATGATCACAATAACAAAACATGCACAAAAATTATCTCTTGCAGGTC
CATTTATGTAAGTTAGGATATACAGATAAAGAAAGTTTTAGTAAAACAAGCAATAAGGAAATGGCTGAGGTTACTATGTCTTCAATCCTAGTAAAGCAAA
CAATAACATCTTTTAGTAACATGTTCTGGATGTGAGGACCAGATACCGGCTAGGGTACCATGTGGACAACATAAGAAGGTGTTAACTTCAAATTTCAGAC
ACACTTATTGAGCTGTGCGCGGCTGGTTGGTTAAGTGTGACTCAGAACTACCTGTCATTTATGTTATATTTTACATGTTATGCTTCTAGAACAAAAGTAG
ATTCCAAGATGGATGCCAATGATGTGCAAGACAAATCTGATGGCAAGGGCATGTATAATTTACTTGTTGCAACCAGAAAAATTTGCAAAATGGTGACAAC
TTCCTTTCCATTTGGCTGGAGGAGGACCAAGGCCATCATCCTTAAAGCTCTTTGATTGAGGAGTTACCCCTGTCAAAACATTTTCAAGAAAATATGATTG
CTGCACTCTATTTTCTTCGCCCAAATGAAAAATTCAAACGATATTAAACCTGTATCGAAGACTCCCACAATAATGTTGCTCTCCCCTTTCAATCCTCTTT
TTCGCTGTTGCAGGCAAGCCAAAAAATTCCCATGGATCTTGAGAATGTAGCTTCCTATATCCATTTGGGAATGACAAAACCCCCTTTTTCCCATGCCTAG
AAAAAAAAAAAACTCAATTTTTTAGC
>LE_HBa0186L05_T7_66201 (trimmed for quality and cloning vector)
AGCATTGCTTGATGATCACAATAACAAAACATGCACAAAAATTATCTCTTGCAGGTCCATTTATGTAAGTTAGGATATACAGATAAAGAAAGTTTTAGTA
AAACAAGCAATAAGGAAATGGCTGAGGTTACTATGTCTTCAATCCTAGTAAAGCAAACAATAACATCTTTTAGTAACATGTTCTGGATGTGAGGACCAGA
TACCGGCTAGGGTACCATGTGGACAACATAAGAAGGTGTTAACTTCAAATTTCAGACACACTTATTGAGCTGTGCGCGGCTGGTTGGTTAAGTGTGACTC
AGAACTACCTGTCATTTATGTTATATTTTACATGTTATGCTTCTAGAACAAAAGTAGATTCCAAGATGGATGCCAATGATGTGCAAGACAAATCTGATGG
CAAGGGCATGTATAATTTACTTGTTGCAACCAGAAAAATTTGCAAAATGGTGACAACTTCCTTTCCATTTGGCTGGAGGAGGACCAAGGCCATCATCCTT
AAAGCTCTTTGATTGAGGAGTTACCCCTGTCAAAACATTTTCAAGAAAATATGATTGCTGCACTCTATTTTCTTCGCCCAAATGAAAAATTCAAACGATA
TTAAACCTGTATCGAAGACTCCCACAATAATGTTGCTCTCCCCTTTCAATCCTCTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963577
Expected error %
0.471762
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g00230.1 Score 67 E Value 3e-14 Identity 69.00% Align. Length 253bp (38.39%) Frame 1
68417.m00025 subtilisin-like serine endopeptidase (XSP1) identical to subtilisin-type serine endopeptidase XSP1 GI:6708179 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_567155.1| Score 67 E Value 1e-12 Identity 69.00% Align. Length 253bp (38.39%) Frame 1
subtilisin-like serine endopeptidase (XSP1) [Arabidopsis thaliana] gb|AAF25830.1| subtilisin-type serine endopeptidase XSP1 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80781.1| Score 67 E Value 1e-12 Identity 69.00% Align. Length 253bp (38.39%) Frame 1
putative cucumisin protease [Arabidopsis thaliana] gb|AAC19302.1| contains similarity to the subtilase family of serine proteases (Pfam: subtilase.hmm, score: 47.57); strong similarity to Cucumis melo (muskmelon) cucumisin (GB:D32206) [Arabidopsis thaliana] pir||T01351 subtilisin-like proteinase homolog F6N15.3 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0186L05
Clone
Clone name
hba-186l5
LE_HBa0186L05
P186L05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found