Clone Read LE_HBa0068A12_SP6_66454

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0068A12_SP6_66454
Primer
SP6
ID from Seq. Facility
LE_HBa_068_A12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
670 trimmed for vector and quality, 830 raw
Sequence
>LE_HBa0068A12_SP6_66454 (raw untrimmed)
GTTTTCGTTANGTTCNCTNNAGTGTGAGATTTGGCTAGATGCAGTGTCCTTCTTGGGACACGTGGTTTCTACCGATGGAGTGATGGTGGATCCTTCTAAG
ATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTCGTCAAGGGATTCT
CTTCTATCGCTTCCCAATTGACGAACTTGACTAAGCAGAATGTTCCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTT
GACTACCGCACCTATCCTTACCTTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTACTAATGCAAGAG
AAGAGTGTGATTGCTTATGCTTCAAGGCAACTAAAGGTGCATGAACGTAACTATCCGACCCACGATTTGGAATTGGCTGCGGTGGTGTTTGCATTAAAGC
AATGGAGACACTATTTATATGGGGTTAAGTGTGAGATCTATACGGATCATCGTAGCCTTCAGTATGTCTTTACTCAGAAAGATTTAAACTTAAGACAGAG
GAGATGGATGGAGTTACTAAAGGACTACGATATCACTATCTTGTATCATCCCGGGGAAGGCGAATGTTGTAGCGGATGCTTTAAGTAGAAAGGCTGGAAG
CCTGGGAAGTCTAACTCACTTTGCAGCTTCTAGACGCCCATTGGCTATAGAGGTTTCAACTCTAGCTAATGGCTTTGATGAAATTATAAATTAATTAGAG
GGGAGGATTGTTTGCCTTCCTGTGGGAGGC
>LE_HBa0068A12_SP6_66454 (trimmed for quality and cloning vector)
ATTTGGCTAGATGCAGTGTCCTTCTTGGGACACGTGGTTTCTACCGATGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAAGAATTGGGTAAGAC
CTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTCGTCAAGGGATTCTCTTCTATCGCTTCCCAATTGACGAACTT
GACTAAGCAGAATGTTCCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCTATCCTTACCTTGCCA
GTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTACTAATGCAAGAGAAGAGTGTGATTGCTTATGCTTCAAGGC
AACTAAAGGTGCATGAACGTAACTATCCGACCCACGATTTGGAATTGGCTGCGGTGGTGTTTGCATTAAAGCAATGGAGACACTATTTATATGGGGTTAA
GTGTGAGATCTATACGGATCATCGTAGCCTTCAGTATGTCTTTACTCAGAAAGATTTAAACTTAAGACAGAGGAGATGGATGGAGTTACTAAAGGACTAC
GATATCACTATCTTGTATCATCCCGGGGAAGGCGAATGTTGTAGCGGATGCTTTAAGTAGAAAGGCTGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.978845
Expected error %
0.298465
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 315 E Value 8e-88 Identity 69.90% Align. Length 663bp (98.96%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 313 E Value 3e-87 Identity 69.90% Align. Length 663bp (98.96%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0068A12
Clone
Clone name
hba-68a12
LE_HBa0068A12
P068A12
Clone type
BAC
Contamination
none
Estimated length
114,561
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found