Clone Read LE_HBa0068C05_T7_66537

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0068C05_T7_66537
Primer
T7
ID from Seq. Facility
LE_HBa_068_C05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
358 trimmed for vector and quality, 885 raw
Sequence
>LE_HBa0068C05_T7_66537 (raw untrimmed)
GTTAAGACTGGCCCCGGGGGGTCCTTCTTAGAGTCGACCTGCAGGCATGCAAGCTTAGGATGTATAGAAACGCCTTTCCATATTAGCCTCCTTAGCCAAG
AATATTGGAGGTTTGACTGACAGTAAAAATATGTCGAGTACTGAAAAGTTAGCTATGTTTTTAAATATTTTGGCTCATCATGAAAAGAACAGGTCTATCA
AAGTTGATTATATTAGATCGGGGTGGAGTGTAAGTCGAGCCTTTAATGAATGTCTAAGAGCTATTCTTAAACTAACTCCAGTGTTACTTGTTAAACCTAA
TCCGGTGCTCGAAGCTGATAGTGATGATCGATGGAAATGGTTTAAGGTAGGTAAATTTCAATCTAACATTTGATTTACTACAATAAACTTGAAATATTAT
GGTGAAAGTATTTTTATTTTTAATAGTCATTTAGTATTTAGATTTGAATTTATCTTATATGGTTGTCTTGGTGCATTGGATGGTACTTACATTTCCTATA
GAGTTTAAGCTATATATATACCAAGAAATTGAACACGAAAATGATATATAGCATCTAATGTCTAGGGGGTTTGTGAAATCAATCTCTACTTTTTATAAAA
TCTACCACTATGGAGGGATTTTACCCTAATGTTCTCATCTAACACTGATCTGAACCTATAAATTACCCATAAAAAGTTCACATCACCACCACACTAAAAG
CTATACGTGCGCACACCTCGTCCGCTCTCTACTCTCCTATTTGTATATTTTCTCATTTTCCTATTTTTTCTGTGTTTCGTGATGTCCTTTTATAGTATCT
ATACTATGTTTTATTATCTTATCAATATTACTTTTGATAATTTGTTGTGATCTTGTCCGTTGTCTCGCCGTGAGATGTTTTTAGT
>LE_HBa0068C05_T7_66537 (trimmed for quality and cloning vector)
GAAACGCCTTTCCATATTAGCCTCCTTAGCCAAGAATATTGGAGGTTTGACTGACAGTAAAAATATGTCGAGTACTGAAAAGTTAGCTATGTTTTTAAAT
ATTTTGGCTCATCATGAAAAGAACAGGTCTATCAAAGTTGATTATATTAGATCGGGGTGGAGTGTAAGTCGAGCCTTTAATGAATGTCTAAGAGCTATTC
TTAAACTAACTCCAGTGTTACTTGTTAAACCTAATCCGGTGCTCGAAGCTGATAGTGATGATCGATGGAAATGGTTTAAGGTAGGTAAATTTCAATCTAA
CATTTGATTTACTACAATAAACTTGAAATATTATGGTGAAAGTATTTTTATTTTTAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947729
Expected error %
0.286984
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89759.1| Score 110 E Value 9e-24 Identity 25.00% Align. Length 215bp (60.06%) Frame 3
hypothetical protein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38700.1| Score 110 E Value 1e-23 Identity 27.10% Align. Length 191bp (53.35%) Frame 3
hypothetical protein PGEC446J10.4 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0068C05
Clone
Clone name
hba-68c5
LE_HBa0068C05
C02HBa0068C05
P068C05
Clone type
BAC
Contamination
none
Estimated length
77,534
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found