Clone Read LE_HBa0068J14_SP6_66890

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0068J14_SP6_66890
Primer
SP6
ID from Seq. Facility
LE_HBa_068_J14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
599 trimmed for vector and quality, 825 raw
Sequence
>LE_HBa0068J14_SP6_66890 (raw untrimmed)
AATCTGGCGGCGCAAGTAGACAAAAAGAATATGCAGATCAAAAGGTTAGAGACTTAGAGTTCATGGAGGGTCAATAAGTCTTGTTGAAAGTTTCACCCAT
GAAAGGGGTGATGCGGTTTGGAAAAAGGGGTAAACTAAGTCCAAGGTACATTGGACCATTTGAAGTACTTAAGCGAGTAGGGGAGGTGGCTTATGAGTTA
GCCTTGCCTCCAGGGCTGTCCGGAGTACACTCGGTATTCCATGTGTCGATGTTGAAAAGATACCATGGGAATGGAAACTACATCATCCGTTGGGATTCAA
TTTTGCTTGATGAGAACTTGTCTTATGAGGAGGAGCCTGTTGCTATTTTAGATAGAGAAGTTCGCAAGTTGAGGTCAAGAGAGATTGCATCCATCAAGGT
GCAATGGAAGAATCGACCCGTTGAAGAAGCCACTTGGGAGAAGGAGGCGGATATGCGAGAAAAATACCCACATCTGTTTACAAATTCAGGTACTCCTTTT
CGCCCTTGTTTTCCTTCTTTTGATCGTTCGGGGACGAACGATGGGTAAATTGGTATCTATTGTAACGACCTGTTTAGTCTTTTTGAGCAACAAACTTCAA
TTCTGGAAAAACTGGCAGAAGCGACGGACCCCACGACGGACCGTCAAGGGCACCATGGACCGTCGCAGGGTCTCATTTCAAAAAACTTAGAAAAATTGAA
ATTGGGTACTGAAAAATGACTCTCTTGAACTTCTTGACTGAATGGGAAGGATGACCCTTCAAAAGTCTGTACAAACCTTCATTTAAAACTCTCTTCTAAA
AATTCAATTCTTTAATATTTCCCAA
>LE_HBa0068J14_SP6_66890 (trimmed for quality and cloning vector)
GTAGACAAAAAGAATATGCAGATCAAAAGGTTAGAGACTTAGAGTTCATGGAGGGTCAATAAGTCTTGTTGAAAGTTTCACCCATGAAAGGGGTGATGCG
GTTTGGAAAAAGGGGTAAACTAAGTCCAAGGTACATTGGACCATTTGAAGTACTTAAGCGAGTAGGGGAGGTGGCTTATGAGTTAGCCTTGCCTCCAGGG
CTGTCCGGAGTACACTCGGTATTCCATGTGTCGATGTTGAAAAGATACCATGGGAATGGAAACTACATCATCCGTTGGGATTCAATTTTGCTTGATGAGA
ACTTGTCTTATGAGGAGGAGCCTGTTGCTATTTTAGATAGAGAAGTTCGCAAGTTGAGGTCAAGAGAGATTGCATCCATCAAGGTGCAATGGAAGAATCG
ACCCGTTGAAGAAGCCACTTGGGAGAAGGAGGCGGATATGCGAGAAAAATACCCACATCTGTTTACAAATTCAGGTACTCCTTTTCGCCCTTGTTTTCCT
TCTTTTGATCGTTCGGGGACGAACGATGGGTAAATTGGTATCTATTGTAACGACCTGTTTAGTCTTTTTGAGCAACAAACTTCAATTCTGGAAAAACTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96635
Expected error %
0.309857
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 211 E Value 1e-53 Identity 21.00% Align. Length 476bp (79.47%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 204 E Value 1e-51 Identity 20.50% Align. Length 476bp (79.47%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0068J14
Clone
Clone name
hba-68j14
LE_HBa0068J14
P068J14
Clone type
BAC
Contamination
none
Estimated length
94,897
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found