Clone Read LE_HBa0068J14_T7_66891

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0068J14_T7_66891
Primer
T7
ID from Seq. Facility
LE_HBa_068_J14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
770 trimmed for vector and quality, 901 raw
Sequence
>LE_HBa0068J14_T7_66891 (raw untrimmed)
CTTAACTCGGTCCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACAAAGATTCCTAGAGAGCCAAAGAAAGTGCAGTTGGAAATGGTCC
ATACAGATGTTTGGGAACCATCTCCAGTATCATCACTTGGAGGATCTAGATTCTATGTTACCTTCATTAATGATTTCAGCAGGAAGGTATGAGCTTACTT
CTTAAAGCATAAGTCAGATGTGTTTGCAACTTTCAAGAAGTGGAAAGCTGAAGTTGAGAATCAGACCGGTTTGAAAGTCAAATGCCTAAGGTCAGACAAT
GGAGGAGAGTATGACAAATCCGAGATCAAGGCATTCTGTGCAGCTGAGGGAATCAGATTGATGAAAACAGTTCCTGGTAAGGCAAGGCAGAACGAAATTG
CTAAGAGGATGAACACAACATTGAATGAGCGTGCAAGGAGTATGAGGATACATTGTGGGCTGCCCAAAACACTTTGGGCGGATCCTGTGAGCACAGTTGC
ATACTTGATCAACAGGGGACCATTAGTTCCTTTAGGGTTCAAGATTCCAGAGGAGATGTGGACAGGAAAAGAGTTCAAGTACTCACACTTGAGGACTTTT
GGTTGCACTGCTTATGTTCATGTTGATCAAGAAAAGAGAGACAAGCTTGATGCCAAGGCTGTGAAGTGTTACTTCATAGGCTATGGTTCTGATTTGTTTG
GTTACAGATTTTGGGATGACAAGAATAGAAAGATCCTGAGACATTGTGATGTGACATTTGATGAGTCTGTCCTATACAAGGACAGAGAGCAGAAGGTTCT
AGAGATTACAAAGCAAGTGGGAGTTTGAGGTTAGTTGGAGAAGAGTAACCAAGAGATGTCAAAGCAGATACACTAACAACTCCTCTGGAAAATGAAAAGT
G
>LE_HBa0068J14_T7_66891 (trimmed for quality and cloning vector)
AGCTTCACAAAGATTCCTAGAGAGCCAAAGAAAGTGCAGTTGGAAATGGTCCATACAGATGTTTGGGAACCATCTCCAGTATCATCACTTGGAGGATCTA
GATTCTATGTTACCTTCATTAATGATTTCAGCAGGAAGGTATGAGCTTACTTCTTAAAGCATAAGTCAGATGTGTTTGCAACTTTCAAGAAGTGGAAAGC
TGAAGTTGAGAATCAGACCGGTTTGAAAGTCAAATGCCTAAGGTCAGACAATGGAGGAGAGTATGACAAATCCGAGATCAAGGCATTCTGTGCAGCTGAG
GGAATCAGATTGATGAAAACAGTTCCTGGTAAGGCAAGGCAGAACGAAATTGCTAAGAGGATGAACACAACATTGAATGAGCGTGCAAGGAGTATGAGGA
TACATTGTGGGCTGCCCAAAACACTTTGGGCGGATCCTGTGAGCACAGTTGCATACTTGATCAACAGGGGACCATTAGTTCCTTTAGGGTTCAAGATTCC
AGAGGAGATGTGGACAGGAAAAGAGTTCAAGTACTCACACTTGAGGACTTTTGGTTGCACTGCTTATGTTCATGTTGATCAAGAAAAGAGAGACAAGCTT
GATGCCAAGGCTGTGAAGTGTTACTTCATAGGCTATGGTTCTGATTTGTTTGGTTACAGATTTTGGGATGACAAGAATAGAAAGATCCTGAGACATTGTG
ATGTGACATTTGATGAGTCTGTCCTATACAAGGACAGAGAGCAGAAGGTTCTAGAGATTACAAAGCAAGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957718
Expected error %
0.250313
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA32025.1| Score 252 E Value 9e-66 Identity 17.30% Align. Length 680bp (88.31%) Frame 2
unnamed protein product [Nicotiana tabacum] sp|P10978|POLX_TOBAC Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Contains: Protease ; Reverse transcriptase ; Endonuclease]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK29467.1| Score 245 E Value 1e-63 Identity 17.00% Align. Length 698bp (90.65%) Frame 2
polyprotein-like [Lycopersicon chilense]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0068J14
Clone
Clone name
hba-68j14
LE_HBa0068J14
P068J14
Clone type
BAC
Contamination
none
Estimated length
94,897
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found