Clone Read LE_HBa0068M21_T7_67049

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0068M21_T7_67049
Primer
T7
ID from Seq. Facility
LE_HBa_068_M21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
677 trimmed for vector and quality, 851 raw
Sequence
>LE_HBa0068M21_T7_67049 (raw untrimmed)
ATTAAAAGGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCCTTCCTCTCCATCTCTAGCTTGTGCTCGTCCCCAAAACTTCGTT
CAAGAAGATTAACTTGTTCTTCACTAAGCAACTTTCTCTTCTTCATCACAACCTCACTAGTGTTGTTTCTCCCTTCAATTTCGTTCTTCTTCCTTCTCCT
TCGCGGTTTCACCGTCTCTCCTAAAGAGACGAAGGTATAAACATCATGTTTACAACATTAATAGTCAAAGAAATTATGATCCTTTTCGATAATTTGTTTT
TACAATACATACTCGAAGAAATTAAAGTTAAAGTTGTTGTTCTAACCTTGTTGTTGTGCTAATTGGGCGTAAATATGAGGGTAGAAGTGAGAAATGAGTT
CCATTTGATCATCAACCTTGCTGCTTGTCATAATCCCTTTCCTTCTCTCTTGTTATTGCTTTTGTTTATTGATGTAGAAAATGAAATGAAAGTGGATATA
TAGCTTGAAAGTGTAGAAAGGAATACTTTTAAAAAATTATGGTATTTGGTGGGACTTTATTTTATAGAACTAGCTAGTTGTATGGGATGCACCTTCTTTC
TCTCTTGATGTTCACATGTCCTGTTCAGAACGACAATAACATATCTAATGTAATTTTACATAGAATTTGAGGATGACATTAGAATACTGTATACAAAGAC
TTTATCTCTATCTTTGTGCGAATCCCATCCGTCAATTGTTTGGAATATTCTCTCTCTATATTATACTAGCTTGAGAGTTGAGCCAATTAGGTGAAATATA
CTTTTTATTTAATTTGAGAAAAGCAAAAAGGGATGGAAATTTAAAGAAATG
>LE_HBa0068M21_T7_67049 (trimmed for quality and cloning vector)
CTAGAGTCGACCTGCAGGCATGCAAGCTTGGCCTTCCTCTCCATCTCTAGCTTGTGCTCGTCCCCAAAACTTCGTTCAAGAAGATTAACTTGTTCTTCAC
TAAGCAACTTTCTCTTCTTCATCACAACCTCACTAGTGTTGTTTCTCCCTTCAATTTCGTTCTTCTTCCTTCTCCTTCGCGGTTTCACCGTCTCTCCTAA
AGAGACGAAGGTATAAACATCATGTTTACAACATTAATAGTCAAAGAAATTATGATCCTTTTCGATAATTTGTTTTTACAATACATACTCGAAGAAATTA
AAGTTAAAGTTGTTGTTCTAACCTTGTTGTTGTGCTAATTGGGCGTAAATATGAGGGTAGAAGTGAGAAATGAGTTCCATTTGATCATCAACCTTGCTGC
TTGTCATAATCCCTTTCCTTCTCTCTTGTTATTGCTTTTGTTTATTGATGTAGAAAATGAAATGAAAGTGGATATATAGCTTGAAAGTGTAGAAAGGAAT
ACTTTTAAAAAATTATGGTATTTGGTGGGACTTTATTTTATAGAACTAGCTAGTTGTATGGGATGCACCTTCTTTCTCTCTTGATGTTCACATGTCCTGT
TCAGAACGACAATAACATATCTAATGTAATTTTACATAGAATTTGAGGATGACATTAGAATACTGTATACAAAGACT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95398
Expected error %
0.0165375
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|M22004.1:1-60 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.58%) Frame 2
Synthetic cloning vector plasmid pSU2719 DNA
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U75992.1:1-75 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.58%) Frame 2
Cloning vector pPAC4
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0068M21
Clone
Clone name
hba-68m21
LE_HBa0068M21
P068M21
Clone type
BAC
Contamination
none
Estimated length
104,424
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found