Clone Read LE_HBa0033D23_T7_6717

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0033D23_T7_6717
Primer
T7
ID from Seq. Facility
LE_HBa_033_D23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
648 trimmed for vector and quality, 879 raw
Sequence
>LE_HBa0033D23_T7_6717 (raw untrimmed)
GTAAGCCGGTTCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCTCGGCTGTTGCTCTGCATCTGCCTTGTTAGAGATCTATTCGCCCAC
TCCCCCTTCGTGCTTGGGGCAATTGATGTTTGTTCTTTGATATCCATGTGGTATTTTCTCTTGCCCTCCGAGGACCTTTTTGGCCATCAATTTTTTGCTG
ATGATATATCCGCTTATATGATCTGTATGGGTACCGAATGCAACTCTGATCTAATTACAGCACCTTTGCCTCCCGTTGATAGCAAACTTAGACCAACCTA
GCCTTGAGTTCTGGGAAGTTTATTACCAATATGGAAATCTAAAGTAGCCCTTTACACATTAGAATACATGGTGTTCGATTAAAAGTGAAATGACTAACCT
GAAATGCCTTACGGACCAAGTGAGCTGACGCTGCTCATGTAGAAGACATATTCTTTGATCTCTTCCTGGTTCTGGAGTTCAATTAGCATTTATGTTGCCT
TCTTTCTTCTACCACTCTCCACTGCTTTTTGTTAACATAATCATCTCGTCGACTGGTGCAGATACAACATAATGGCGTCATCGTAAATATCTTCCGTGTT
ATCGATCAGTGTGGCGTCCTGCTGTTTAATTCTGGAATGATGAAGCTTTTTCTTTTTGGATCTTATAACCGATTGCAACTTCTTAATGTTATTATCTCCA
TCTGAGAACCATTTGACACTGACTCACCATTATCGCTTTCTTACTCAGCACCATCATTTTCGTCATGTATGTTCAACCTCGTAGGATTTCTTGCTTCATA
TTTGTAGTAACTATGGTCTTGTGTGATGTTCTAGGGGCTTGTGCTGCAGGATGTGAGACGGCTATCCTGCATTAATGTG
>LE_HBa0033D23_T7_6717 (trimmed for quality and cloning vector)
AGCTTGCTCGGCTGTTGCTCTGCATCTGCCTTGTTAGAGATCTATTCGCCCACTCCCCCTTCGTGCTTGGGGCAATTGATGTTTGTTCTTTGATATCCAT
GTGGTATTTTCTCTTGCCCTCCGAGGACCTTTTTGGCCATCAATTTTTTGCTGATGATATATCCGCTTATATGATCTGTATGGGTACCGAATGCAACTCT
GATCTAATTACAGCACCTTTGCCTCCCGTTGATAGCAAACTTAGACCAACCTAGCCTTGAGTTCTGGGAAGTTTATTACCAATATGGAAATCTAAAGTAG
CCCTTTACACATTAGAATACATGGTGTTCGATTAAAAGTGAAATGACTAACCTGAAATGCCTTACGGACCAAGTGAGCTGACGCTGCTCATGTAGAAGAC
ATATTCTTTGATCTCTTCCTGGTTCTGGAGTTCAATTAGCATTTATGTTGCCTTCTTTCTTCTACCACTCTCCACTGCTTTTTGTTAACATAATCATCTC
GTCGACTGGTGCAGATACAACATAATGGCGTCATCGTAAATATCTTCCGTGTTATCGATCAGTGTGGCGTCCTGCTGTTTAATTCTGGAATGATGAAGCT
TTTTCTTTTTGGATCTTATAACCGATTGCAACTTCTTAATGTTATTAT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.968486
Expected error %
5.87879
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0033D23
Clone
Clone name
hba-33d23
LE_HBa0033D23
P033D23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found