Clone Read LE_HBa0033E18_SP6_6754

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0033E18_SP6_6754
Primer
SP6
ID from Seq. Facility
LE_HBa_033_E18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
851 trimmed for vector and quality, 973 raw
Genbank Accession
Sequence
>LE_HBa0033E18_SP6_6754 (raw untrimmed)
GGAACCATANCCTGGTTATAACGTTCATAAAGTTTTTTATGTCCTAAGTTGACAGCCTAAATACAATTGCATCCCTTTTAACGTTTCTCCCCCATTTTCT
TTTTATGCAATTCTCATTTTATATTTAATAAATGTTAATGCATTGTCATTCATAATAGCATTTGAGATTCCAAAATTAAGATTTTGTGACATAAACATTT
CATTTGAATGATCGGTGGCCTAGAAGAATCTTATTTTCATCTTCCATTGAATGGAGTATCATTTTCATTTCATGTTCTAGATAATTGCTCTTCGAAGAGC
GAAGAGAAGAAACATGGAACGCTTGGTTTTGGCATGTGGTGGTGATGCAGTTAACTCTGTTGATGACCTTACTCCTGAGTGCCTTGGCTGGGCCGGTCTG
GTGTATGAGCATGTTCTTGGCGAAGAGAAGTATACATTTGTAGAAAATGTCAAAAATCCTCATTCCTGCACTATTCTTATAAAAGGTATTTTGACTTATT
TTGGTTTTTGTTTTATGTTTTTTCATGTGAACTCTATTGTTTTGCTGTGGTGGTCCAGTAATGTCACTGTTTGAGGAATTGTTCTGTTAAACTCCGTTGT
TTTCTATTTAGGGCCAAATGACCATACAATAGCACAAATTAAAGATGCTGTTCGTGATGGACTGAGAGCAGTCAAAAATACCATTGAAGATGAAGCAGTT
ATACTGGTATGTTAGTCCATTGATACCTGGAACTGTAGAAAATGAATATTTTGTGTGATTTCCATGTAGAAGTGCCCTCACTTGATGGCTTTTTCTTTGA
TTGCGTATTATTTTGACTGTCGTATCTATCTTTGGGCCGAAATTTATGTACATAGAATTATGATGCTTTGCATGTGCCTATATTTGGTAATGAAGTTTGA
GCTTTATTTGTTCTAAATAATGTATTCTCTTATATCATGAGAAAGAATAACCCATCTCCTGTCCCGAGGAAAT
>LE_HBa0033E18_SP6_6754 (trimmed for quality and cloning vector)
CATAAAGTTTTTTATGTCCTAAGTTGACAGCCTAAATACAATTGCATCCCTTTTAACGTTTCTCCCCCATTTTCTTTTTATGCAATTCTCATTTTATATT
TAATAAATGTTAATGCATTGTCATTCATAATAGCATTTGAGATTCCAAAATTAAGATTTTGTGACATAAACATTTCATTTGAATGATCGGTGGCCTAGAA
GAATCTTATTTTCATCTTCCATTGAATGGAGTATCATTTTCATTTCATGTTCTAGATAATTGCTCTTCGAAGAGCGAAGAGAAGAAACATGGAACGCTTG
GTTTTGGCATGTGGTGGTGATGCAGTTAACTCTGTTGATGACCTTACTCCTGAGTGCCTTGGCTGGGCCGGTCTGGTGTATGAGCATGTTCTTGGCGAAG
AGAAGTATACATTTGTAGAAAATGTCAAAAATCCTCATTCCTGCACTATTCTTATAAAAGGTATTTTGACTTATTTTGGTTTTTGTTTTATGTTTTTTCA
TGTGAACTCTATTGTTTTGCTGTGGTGGTCCAGTAATGTCACTGTTTGAGGAATTGTTCTGTTAAACTCCGTTGTTTTCTATTTAGGGCCAAATGACCAT
ACAATAGCACAAATTAAAGATGCTGTTCGTGATGGACTGAGAGCAGTCAAAAATACCATTGAAGATGAAGCAGTTATACTGGTATGTTAGTCCATTGATA
CCTGGAACTGTAGAAAATGAATATTTTGTGTGATTTCCATGTAGAAGTGCCCTCACTTGATGGCTTTTTCTTTGATTGCGTATTATTTTGACTGTCGTAT
CTATCTTTGGGCCGAAATTTATGTACATAGAATTATGATGCTTTGCATGTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946373
Expected error %
0.121564
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g02530.1 Score 172 E Value 3e-43 Identity 21.70% Align. Length 419bp (49.24%) Frame 2
68416.m00241 chaperonin, putative similar to SWISS-PROT:P80317- T-complex protein 1, zeta subunit (TCP-1-zeta) [Mus musculus]; contains Pfam:PF00118 domain, TCP-1/cpn60 chaperonin family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g16070.1 Score 166 E Value 2e-41 Identity 21.60% Align. Length 416bp (48.88%) Frame 2
68418.m01878 chaperonin, putative similar to SWISS-PROT:P80317 T-complex protein 1, zeta subunit (TCP-1-zeta) [Mus musculus]; contains Pfam:PF00118 domain, TCP-1/cpn60 chaperonin family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF32460.1| Score 172 E Value 1e-41 Identity 21.70% Align. Length 419bp (49.24%) Frame 2
putative chaperonin [Arabidopsis thaliana] gb|AAM47971.1| putative chaperonin [Arabidopsis thaliana] gb|AAL32807.1| putative chaperonin [Arabidopsis thaliana] ref|NP_186902.1| chaperonin, putative [Arabidopsis thaliana] gb|AAN65043.1| putative chaperonin [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM61312.1| Score 172 E Value 1e-41 Identity 21.70% Align. Length 419bp (49.24%) Frame 2
putative chaperonin [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0033E18
Clone
Clone name
hba-33e18
LE_HBa0033E18
C02HBa0033E18
P033E18
Clone type
BAC
Contamination
none
Estimated length
76,444
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found