Clone Read LE_HBa0081N16_SP6_67854

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0081N16_SP6_67854
Primer
SP6
ID from Seq. Facility
LE_HBa_081_N16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
725 trimmed for vector and quality, 816 raw
Sequence
>LE_HBa0081N16_SP6_67854 (raw untrimmed)
GGTATGACTTATAGAAAAAATATTTATGTTATTATTACAATGAACGTAATGTTGTAATGCAAATCAATTTTGCCAACATTTCCTGTATTTTCTTCACAAA
AAACTCCATCCCATTTGCAACAATTTTGTTTTGTCTATGATGACAAACGATTCGAGTTATCGATTTGGCCATTCTTGAACTCAATCAGAGCTTTAATTTT
TGGTCATTTTCAGAACAAGTTATATTGAAATGATGAGTTTTAGTGTAACCAACTTCAAGATTGGTGACAAAAACAAGTAATAGAAGAATCAAAAAGGGAT
GGTAGTTCATATTTTTGTTTAAGTAGAGTACCTATTGTTCTGTTTTCTTGAGGGGTTTTAGCTTTTAAGAACTTCAATGTGTTCTAAGTTTTGTGAAAGT
TGAAAAGATAGATGTTTGTTGATAGAATACAATAAGAATGGTAGATTATGTCAAGTTTGATTTTTGAGTCAAGTGTGAAGTTGACATAATACTAGTTCTA
ATGGACTATATATTGAGTTAACGAACAGAGTTTCATATTGATAATTGAAAAAGATAATAATTAAATATTAGATGTAGAATATAAGACTTGTATTGGAGTT
AATAATCAGCGAGGTGATTACGAAGATAGCATTGGGCCCGACTTGCTGACTAGTAGGCCATTTACTATCTTTATTCGTAGCTTGAACACATAGATAATTA
AAAGGGGAGGTAAGGATCAAATAAAAAATTTATGTACGTTGAGAAAAAAAGGAAGCTACATATAAAATGTATGATAATATTCTTAAGAATGTAAGACTTG
CTAAGAAATCGTTCCA
>LE_HBa0081N16_SP6_67854 (trimmed for quality and cloning vector)
ATATTTATGTTATTATTACAATGAACGTAATGTTGTAATGCAAATCAATTTTGCCAACATTTCCTGTATTTTCTTCACAAAAAACTCCATCCCATTTGCA
ACAATTTTGTTTTGTCTATGATGACAAACGATTCGAGTTATCGATTTGGCCATTCTTGAACTCAATCAGAGCTTTAATTTTTGGTCATTTTCAGAACAAG
TTATATTGAAATGATGAGTTTTAGTGTAACCAACTTCAAGATTGGTGACAAAAACAAGTAATAGAAGAATCAAAAAGGGATGGTAGTTCATATTTTTGTT
TAAGTAGAGTACCTATTGTTCTGTTTTCTTGAGGGGTTTTAGCTTTTAAGAACTTCAATGTGTTCTAAGTTTTGTGAAAGTTGAAAAGATAGATGTTTGT
TGATAGAATACAATAAGAATGGTAGATTATGTCAAGTTTGATTTTTGAGTCAAGTGTGAAGTTGACATAATACTAGTTCTAATGGACTATATATTGAGTT
AACGAACAGAGTTTCATATTGATAATTGAAAAAGATAATAATTAAATATTAGATGTAGAATATAAGACTTGTATTGGAGTTAATAATCAGCGAGGTGATT
ACGAAGATAGCATTGGGCCCGACTTGCTGACTAGTAGGCCATTTACTATCTTTATTCGTAGCTTGAACACATAGATAATTAAAAGGGGAGGTAAGGATCA
AATAAAAAATTTATGTACGTTGAGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.92435
Expected error %
0.0867352
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0081N16
Clone
Clone name
hba-81n16
LE_HBa0081N16
P081N16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found