Clone Read LE_HBa0081N16_T7_67855

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0081N16_T7_67855
Primer
T7
ID from Seq. Facility
LE_HBa_081_N16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
691 trimmed for vector and quality, 747 raw
Sequence
>LE_HBa0081N16_T7_67855 (raw untrimmed)
CTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACCGTCAACTCTTGTTGACCACCCCTTGACGAGGTGATTACATCTCTGGATC
CATTCTATTCGAACTTTCACTTTTCCAGTCCACTACCGATGGGAAGAAGTTTGTTGATGTCTTGCGCGATCAGAAGATTGTACCTGGAATCAAAGTTGAC
AAGGTGTCCTTTTTAACTTGTTTCTATGCCTTGTGTAACTTCTTCTGTGCTTTAGGATTTTGCTGCTACCTTTCTTAAACTTTTGTTGCAAATATTTTTG
TTGGTGAACTTCGTGCAATTTAACAGTTCTTTTTTTACTTACAGGGTTTGGTTCCCCTACCAGGATCCAACAATGAATCCTGGTGCCAAGGATTGGATGG
ATTGGCTTCTAGGTCTGCTGAATACTACAAGCAAGGGGCACGTTTTGCCAAGTGGTATGTTGTGACCTTGCACTTTTCTACTGCTATTCCTCTCTCATGT
TTTCTCTTATTCTTTCCTCGGAAGATCAAAGTGCATTTAACTTTTCTGAAGAGTTATGGAACATAAATGGCATGCGGCTTCAAAATTTTCAGGAGAACAG
TTGTTAGCATTCCTTGCGGTCCTTCTGCTTTGGCTGTAAAAGAAGCAGCTTGGGGTCTTGCTCGATATGCTGCTATATCTCAGGTAACTTTTAGGACTTT
TTCTATCTTTCCGAAGTTGTACTAGAAAATGTGAGATAATTAATTCA
>LE_HBa0081N16_T7_67855 (trimmed for quality and cloning vector)
AGCTTACCGTCAACTCTTGTTGACCACCCCTTGACGAGGTGATTACATCTCTGGATCCATTCTATTCGAACTTTCACTTTTCCAGTCCACTACCGATGGG
AAGAAGTTTGTTGATGTCTTGCGCGATCAGAAGATTGTACCTGGAATCAAAGTTGACAAGGTGTCCTTTTTAACTTGTTTCTATGCCTTGTGTAACTTCT
TCTGTGCTTTAGGATTTTGCTGCTACCTTTCTTAAACTTTTGTTGCAAATATTTTTGTTGGTGAACTTCGTGCAATTTAACAGTTCTTTTTTTACTTACA
GGGTTTGGTTCCCCTACCAGGATCCAACAATGAATCCTGGTGCCAAGGATTGGATGGATTGGCTTCTAGGTCTGCTGAATACTACAAGCAAGGGGCACGT
TTTGCCAAGTGGTATGTTGTGACCTTGCACTTTTCTACTGCTATTCCTCTCTCATGTTTTCTCTTATTCTTTCCTCGGAAGATCAAAGTGCATTTAACTT
TTCTGAAGAGTTATGGAACATAAATGGCATGCGGCTTCAAAATTTTCAGGAGAACAGTTGTTAGCATTCCTTGCGGTCCTTCTGCTTTGGCTGTAAAAGA
AGCAGCTTGGGGTCTTGCTCGATATGCTGCTATATCTCAGGTAACTTTTAGGACTTTTTCTATCTTTCCGAAGTTGTACTAGAAAATGTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955101
Expected error %
0.519788
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01140.1 Score 169 E Value 1e-42 Identity 16.60% Align. Length 638bp (92.33%) Frame 3
68415.m00023 fructose-bisphosphate aldolase, putative similar to plastidic aldolase NPALDP1 from Nicotiana paniculata [GI:4827251]; contains Pfam profile PF00274 Fructose-bisphosphate aldolase class-I
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g38970.2 Score 151 E Value 4e-37 Identity 15.00% Align. Length 638bp (92.33%) Frame 3
68417.m05522 fructose-bisphosphate aldolase, putative strong similarity to plastidic fructose-bisphosphate aldolase (EC 4.1.2.13) from Nicotiana paniculata (NPALDP1) [GI:4827251], Oryza sativa, PIR2:T02057 [SP|Q40677]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_909004.1| Score 173 E Value 4e-42 Identity 16.60% Align. Length 638bp (92.33%) Frame 3
putative plastidic aldolase [Oryza sativa (japonica cultivar-group)] dbj|BAB55475.1| putative plastidic aldolase [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP80661.1| Score 171 E Value 1e-41 Identity 16.40% Align. Length 638bp (92.33%) Frame 3
aldolase [Triticum aestivum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0081N16
Clone
Clone name
hba-81n16
LE_HBa0081N16
P081N16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found