Clone Read LE_HBa0128B04_T7_68791

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0128B04_T7_68791
Primer
T7
ID from Seq. Facility
LE_HBa_128_B04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
643 trimmed for vector and quality, 858 raw
Genbank Accession
Sequence
>LE_HBa0128B04_T7_68791 (raw untrimmed)
GGAGAGTTGGGTACCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTCATTCCTCTTTCTCCATATGGTTCACATCAGGGCTAAAGGTGCA
ACTTCACATGCTCTGCATCTCCTCCTCCATCTTCTACGAGCCCAGCTAAACATCATTTCTTTCACAGTTTTCGACATTACCCACTTAAAACCAAGCCATC
TCATCACCTCCCCCCTCCCCCATAACAAAGATGCTACCTGGCAATGTAAGAGTACGTGATCTATGTCTTCTCCTGATTCTTGTACATGAAGCACCAACTA
ACAGACATAGTCCTTCTCTTGCTCAAGCTCTCTGCAGTCAGGATCCCCCTCCCCCCTCGTGGTTAATCGTATGAAGAAGTACTCTAGGGATTCACATCAA
GGTTTGTGGTAAAACAATCTCCTCTCTCACCAAAAGCTTCACATAATAGGGACTTAACGAAAAAGACTCCATTTCCCCCAATTCCCCCATTTCCAAACAC
CCTGACAATCCATAATAATTTTTGTTGGTGGAGCAAGCCAGCAAAGTATTCAAATTCTCCAAACTTCCCAGTCCTGTAAGTTTCTGCTAAACCTCAAAGC
CCCAACAGCTTGACCCCCTTGTAAATTCCATGATTGTATAAACTACGTCTTATTTTGGCCAGAAACCCTCCGCGTGTCAGGGGGAAGCGAGACCTCCTAT
TCTGTTTTTCCCGTCCCAATTGACCCCTAAAACTTCCCCTAACTCCCTAACCCCATCAATAAGAAATATTTCCATGGACTCCTTCTACCCCTTTGAAATA
TTCTTCTCAGTCAACAACGCCCTGATATCTTTGCATTCTCAGGTCTTAACCCCCTTCC
>LE_HBa0128B04_T7_68791 (trimmed for quality and cloning vector)
AGCTTTCTCATTCCTCTTTCTCCATATGGTTCACATCAGGGCTAAAGGTGCAACTTCACATGCTCTGCATCTCCTCCTCCATCTTCTACGAGCCCAGCTA
AACATCATTTCTTTCACAGTTTTCGACATTACCCACTTAAAACCAAGCCATCTCATCACCTCCCCCCTCCCCCATAACAAAGATGCTACCTGGCAATGTA
AGAGTACGTGATCTATGTCTTCTCCTGATTCTTGTACATGAAGCACCAACTAACAGACATAGTCCTTCTCTTGCTCAAGCTCTCTGCAGTCAGGATCCCC
CTCCCCCCTCGTGGTTAATCGTATGAAGAAGTACTCTAGGGATTCACATCAAGGTTTGTGGTAAAACAATCTCCTCTCTCACCAAAAGCTTCACATAATA
GGGACTTAACGAAAAAGACTCCATTTCCCCCAATTCCCCCATTTCCAAACACCCTGACAATCCATAATAATTTTTGTTGGTGGAGCAAGCCAGCAAAGTA
TTCAAATTCTCCAAACTTCCCAGTCCTGTAAGTTTCTGCTAAACCTCAAAGCCCCAACAGCTTGACCCCCTTGTAAATTCCATGATTGTATAAACTACGT
CTTATTTTGGCCAGAAACCCTCCGCGTGTCAGGGGGAAGCGAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962266
Expected error %
1.81947
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0128B04
Clone
Clone name
hba-128b4
LE_HBa0128B04
C02HBa0128B04
P128B04
Clone type
BAC
Contamination
none
Estimated length
85,602
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found