Clone Read LE_HBa0128E05_T7_68937

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0128E05_T7_68937
Primer
T7
ID from Seq. Facility
LE_HBa_128_E05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
834 trimmed for vector and quality, 916 raw
Genbank Accession
Sequence
>LE_HBa0128E05_T7_68937 (raw untrimmed)
TAAAACTGGGTCCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGCTCGCTCAGGGTCATCAGACAGTGGCATGTCTTCAGGAAGTAAACA
AATCTTTGAACCACCATCTTCATCACAATCCATATAGTCAATATCTGAGATCTTATCATTTTTTCTGCTCTCAACCATATTTACATTGAGTCGATCCCCT
ACTTTCTTCCTTCTAGGGGACGAGTCCCATTCATCTACATGGCAGAAAGCCTCCAAATAGTCATCCTTAGGCCCCTCCCCATCATCTCTTCCATAGGTCT
CATCTAGAAAACCATGGCCTTGATATCTTGATTGCTTATCTAGCATTTTCACTGCCGCATTAATATCTAATGGTTTCCAAGAACAGTTCAGAAGCATCTC
AGCCCACTCATTCTCAACATTTTGAGGCAAAACTGACTGCATTTTAGGCAGCAAAGCTCCCATGTGATCATGCACAACATGATGAACGTGTGATTGAGAA
TCAGCAAAATTTTCATTGCACCGGCAACATCTCCAGAACTCCCATGTTTTATGGGTCTCGGCAAATGGAAGAGCATCAGAGAGTACTTCTATAGCCAAAT
GATCCTTAGAAGCAGTAAAATGTGTCTTAAGATCTGAAATTCTAATTCTAAGCAATTCTTTCTTCACATCCAAACTTATGGAATTCCAATATGACTGCAC
CCACTTTCTTCTCTCAGTGGAAGAAGTATTCTTCTTTGCATTTCCGCTGGACCTCCTATCTCGTGCTCTCTGACCCGATCCTGCAGTTGAATCCAAACCT
TTGTCTACTTCATTCTGTGATTTGACAGTTTCTGACTTCTGCTGCAACAGCCTAGCAGCAGCTACCCGAACCTCAATCTCTTTTCTTCTCCCCTCAGGTG
GCTTAGTCGCCCTTTT
>LE_HBa0128E05_T7_68937 (trimmed for quality and cloning vector)
AGCTTTGCTCGCTCAGGGTCATCAGACAGTGGCATGTCTTCAGGAAGTAAACAAATCTTTGAACCACCATCTTCATCACAATCCATATAGTCAATATCTG
AGATCTTATCATTTTTTCTGCTCTCAACCATATTTACATTGAGTCGATCCCCTACTTTCTTCCTTCTAGGGGACGAGTCCCATTCATCTACATGGCAGAA
AGCCTCCAAATAGTCATCCTTAGGCCCCTCCCCATCATCTCTTCCATAGGTCTCATCTAGAAAACCATGGCCTTGATATCTTGATTGCTTATCTAGCATT
TTCACTGCCGCATTAATATCTAATGGTTTCCAAGAACAGTTCAGAAGCATCTCAGCCCACTCATTCTCAACATTTTGAGGCAAAACTGACTGCATTTTAG
GCAGCAAAGCTCCCATGTGATCATGCACAACATGATGAACGTGTGATTGAGAATCAGCAAAATTTTCATTGCACCGGCAACATCTCCAGAACTCCCATGT
TTTATGGGTCTCGGCAAATGGAAGAGCATCAGAGAGTACTTCTATAGCCAAATGATCCTTAGAAGCAGTAAAATGTGTCTTAAGATCTGAAATTCTAATT
CTAAGCAATTCTTTCTTCACATCCAAACTTATGGAATTCCAATATGACTGCACCCACTTTCTTCTCTCAGTGGAAGAAGTATTCTTCTTTGCATTTCCGC
TGGACCTCCTATCTCGTGCTCTCTGACCCGATCCTGCAGTTGAATCCAAACCTTTGTCTACTTCATTCTGTGATTTGACAGTTTCTGACTTCTGCTGCAA
CAGCCTAGCAGCAGCTACCCGAACCTCAATCTCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962572
Expected error %
0.995867
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g47910.1 Score 219 E Value 1e-57 Identity 15.60% Align. Length 830bp (99.52%) Frame 1
68416.m05224 expressed protein low similarity to nonmuscle myosin heavy chain (NMHC) [Homo sapiens] GI:189036; contains Pfam profiles PF04780: Protein of unknown function (DUF629), PF04781: Protein of unknown function (DUF627)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g47890.1 Score 217 E Value 7e-57 Identity 14.70% Align. Length 830bp (99.52%) Frame 1
68416.m05222 ubiquitin carboxyl-terminal hydrolase-related contains Pfam profiles PF00443: Ubiquitin carboxyl-terminal hydrolase, PF04780: Protein of unknown function (DUF629), PF04781: Protein of unknown function (DUF627)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB41148.1| Score 219 E Value 7e-56 Identity 15.60% Align. Length 830bp (99.52%) Frame 1
putative protein [Arabidopsis thaliana] pir||T06692 hypothetical protein T17F15.220 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_190374.2| Score 219 E Value 7e-56 Identity 15.60% Align. Length 830bp (99.52%) Frame 1
expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0128E05
Clone
Clone name
hba-128e5
LE_HBa0128E05
C06HBa0128E05
P128E05
Clone type
BAC
Contamination
none
Estimated length
94,097
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found