Clone Read LE_HBa0128E10_T7_68947

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0128E10_T7_68947
Primer
T7
ID from Seq. Facility
LE_HBa_128_E10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
817 trimmed for vector and quality, 918 raw
Sequence
>LE_HBa0128E10_T7_68947 (raw untrimmed)
GGTGAATGAAGGATTCTCCGCAGCCATGATGCCAGCTCGCCCGGCGTCATGGCGGCTATTTGTGCGCCGACATTAACCAGCGCCTGGGCCGTATCGCGGT
CATAGCAAGGTGTTGCGGTGCTATCGAGCGCTGCCAGTCCCAGCACTTTGATGCCGCTCTGGACACACTTTTTCACCTGATGCGTCAGTAATGATGATGA
ACCCCCTTCGTAAAAATCGCTCACGAGGATAATGACGCTTTTCGCTGGTTGTTCAATAAGTTGCCGACCATACTCCACGGCACTGGCGATATTGGTCCCG
CCGCCCAACTGTACTTTCATTAATAACTCTACCGGATCGGCAACGTCTGCCGTGAGATCAACGACGCTTGTGTCAAACGCCACCAGATGGGTACGAATGC
CGGGTAACTGCCACAAACAGGCCGCCATCACCGCAGAGTGGATCACCGAATCGACCATCGATCCGCTTTGATCAACCAGTAAGACCAGTTGCCATTGTTC
GCTTTGGCGTTTAATGCGGCTGTTAAAGCGGGGGGATTCGATATACAACTTGCCGTGTTGCGGGTGCCAGTGTTGCAGGTTGGCGCGCAGAGTACTTTTG
AAATCAAAGTTTCGCGCCAGTGGAATAAATGAACGGCGACGGCGATCGCGGACACCAGAAAAAGCCTGACGAACTTCCTTTGCCAGTCGAGCCATAATTT
CTTCAACAACCTGGCACACTATCCGGCGGGCGGCAGCCAGTACTTCGGGGTTCATCAGATGTTTGGTGTGCAAAACAGCGCGTAGCAGGCTTTCAGAAGG
CTGCATACGTTCCAGCACGTCGAGATTCGTCACCACATCTTCAATGCCGTAGCGCAGCACGGCATCGCTTTCCAGCCGCTCAATCACCTGCTGCGGAAAC
AGCGTGTGGATACTGTTG
>LE_HBa0128E10_T7_68947 (trimmed for quality and cloning vector)
CAGCCATGATGCCAGCTCGCCCGGCGTCATGGCGGCTATTTGTGCGCCGACATTAACCAGCGCCTGGGCCGTATCGCGGTCATAGCAAGGTGTTGCGGTG
CTATCGAGCGCTGCCAGTCCCAGCACTTTGATGCCGCTCTGGACACACTTTTTCACCTGATGCGTCAGTAATGATGATGAACCCCCTTCGTAAAAATCGC
TCACGAGGATAATGACGCTTTTCGCTGGTTGTTCAATAAGTTGCCGACCATACTCCACGGCACTGGCGATATTGGTCCCGCCGCCCAACTGTACTTTCAT
TAATAACTCTACCGGATCGGCAACGTCTGCCGTGAGATCAACGACGCTTGTGTCAAACGCCACCAGATGGGTACGAATGCCGGGTAACTGCCACAAACAG
GCCGCCATCACCGCAGAGTGGATCACCGAATCGACCATCGATCCGCTTTGATCAACCAGTAAGACCAGTTGCCATTGTTCGCTTTGGCGTTTAATGCGGC
TGTTAAAGCGGGGGGATTCGATATACAACTTGCCGTGTTGCGGGTGCCAGTGTTGCAGGTTGGCGCGCAGAGTACTTTTGAAATCAAAGTTTCGCGCCAG
TGGAATAAATGAACGGCGACGGCGATCGCGGACACCAGAAAAAGCCTGACGAACTTCCTTTGCCAGTCGAGCCATAATTTCTTCAACAACCTGGCACACT
ATCCGGCGGGCGGCAGCCAGTACTTCGGGGTTCATCAGATGTTTGGTGTGCAAAACAGCGCGTAGCAGGCTTTCAGAAGGCTGCATACGTTCCAGCACGT
CGAGATTCGTCACCACA

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.987816
Expected error %
0.056919
Sequence Annotations 
Automatic Annotations
E. coli K12 Genome (E.coli_K12/Ecoli_genome)NCBI BLAST
gi|16127994|ref|NC_000913.1| Score 1618 E Value 0 Identity 100.00% Align. Length 815bp (99.76%) Frame 3
Escherichia coli K12, complete genome
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_416625.1| Score 532 E Value 1e-150 Identity 33.30% Align. Length 815bp (99.76%) Frame 2
hypothetical protein b2121 [Escherichia coli K12] gb|AAC75182.1| orf, hypothetical protein; conserved protein [Escherichia coli K12] gb|AAA60484.1| yehP [Escherichia coli] pir||H64979 hypothetical protein yehP - Escherichia coli (strain K-12) sp|P33352|YEHP_ECOLI Hypothetical protein yehP prf||2014253Q yehP gene
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_708009.2| Score 524 E Value 1e-147 Identity 33.00% Align. Length 815bp (99.76%) Frame 2
hypothetical protein SF2190 [Shigella flexneri 2a str. 301] gb|AAN43716.2| orf, conserved hypothetical protein [Shigella flexneri 2a str. 301] ref|NP_837725.1| hypothetical protein S2315 [Shigella flexneri 2a str. 2457T] gb|AAP17534.1| hypothetical protein S2315 [Shigella flexneri 2a str. 2457T]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0128E10
Clone
Clone name
hba-128e10
LE_HBa0128E10
P128E10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found