Clone Read LE_HBa0128G13_SP6_69048

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0128G13_SP6_69048
Primer
SP6
ID from Seq. Facility
LE_HBa_128_G13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
620 trimmed for vector and quality, 844 raw
Genbank Accession
Sequence
>LE_HBa0128G13_SP6_69048 (raw untrimmed)
GGTAATGTATGTCATGAATTGTAACTGACCAGACATANGCTTGCGCTATCAGTAAACTGAGTCGATACACAAGTTATCCTAATCATAATCATTTGCAATG
AAGAGAGTTTTGGGATACTTAGATGACACTCACAACTATGCTTTACACCAACAAATATCCAACCGTTCTTGAAGGATATAGTGATGCAAATTGGATTACT
AGGTCAACTGAAACAAAATCCACAAGTGGATACGTTTTTACTATTAGTGGAGGAGCAATATCTTGGAAATCATCCAAACAAACATGTATAGCTCGCTCTA
CATTAGAGTCTGAATTTATTGCTTTAAACAAGACAGGTGAAGAAGCTGAATGACTGTGGAATTTCTTAGAAGATATTCCATTTTGGCACAAACCAATGGC
CCCTATATGCATACATTGTGATAGTCAAGCTGCAATAGGAAGGGCTGGAAGCATTACGTATAACGGCAAGTCTCGCCACATAAGACGAAGGCATAACTCT
GTGTGATAACTACTCTCTAGTGGAATTATCACAATTGACTATGTGAAGTCAAAAGATAATGTGTCGGATCCACTTACAAAAGGCCTAAATAGAGAGGGAG
TTGAGAAATCATCGACGGGAATGGGACTATGGCCGAGAACAAGTCATCGTGGCGGTAACTCTACCTAGAAGACTGGAGATCCCCAGATCTAGGTTCAAGG
AGATAAAAACAAAGTCATTGATGACGGTTCCACATTGTCAAAGGGAAAAATAAAATAAAAAATTATTATTATTTTTATGGTCCATTCTTATGAATAAACA
ATGTTTAATACCTAGGAAAAAAAACATAAAGATCTTTTTAATGN
>LE_HBa0128G13_SP6_69048 (trimmed for quality and cloning vector)
TTGCGCTATCAGTAAACTGAGTCGATACACAAGTTATCCTAATCATAATCATTTGCAATGAAGAGAGTTTTGGGATACTTAGATGACACTCACAACTATG
CTTTACACCAACAAATATCCAACCGTTCTTGAAGGATATAGTGATGCAAATTGGATTACTAGGTCAACTGAAACAAAATCCACAAGTGGATACGTTTTTA
CTATTAGTGGAGGAGCAATATCTTGGAAATCATCCAAACAAACATGTATAGCTCGCTCTACATTAGAGTCTGAATTTATTGCTTTAAACAAGACAGGTGA
AGAAGCTGAATGACTGTGGAATTTCTTAGAAGATATTCCATTTTGGCACAAACCAATGGCCCCTATATGCATACATTGTGATAGTCAAGCTGCAATAGGA
AGGGCTGGAAGCATTACGTATAACGGCAAGTCTCGCCACATAAGACGAAGGCATAACTCTGTGTGATAACTACTCTCTAGTGGAATTATCACAATTGACT
ATGTGAAGTCAAAAGATAATGTGTCGGATCCACTTACAAAAGGCCTAAATAGAGAGGGAGTTGAGAAATCATCGACGGGAATGGGACTATGGCCGAGAAC
AAGTCATCGTGGCGGTAACT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970754
Expected error %
0.169284
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89783.1| Score 311 E Value 6e-84 Identity 26.20% Align. Length 617bp (99.52%) Frame 3
putative retrovirus-related pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38766.1| Score 239 E Value 3e-62 Identity 22.70% Align. Length 545bp (87.90%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0128G13
Clone
Clone name
hba-128g13
LE_HBa0128G13
P128G13
Clone type
BAC
Contamination
none
Estimated length
82,712
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found