Clone Read LE_HBa0128G13_T7_69049

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0128G13_T7_69049
Primer
T7
ID from Seq. Facility
LE_HBa_128_G13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
557 trimmed for vector and quality, 913 raw
Genbank Accession
Sequence
>LE_HBa0128G13_T7_69049 (raw untrimmed)
TTACTTGGGTCCGAGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAAGATTTATCAAACATCATATTAATCTTGGTCACAATAATCCAGCCA
AATGATTTTCTCTTTGGACCCTTATCTATCATCCAAACCCATATTATAGCTAGTCTTCCTGGTTTGTTTCATCATATTTTAATCATATTGACCTAGTGTA
TTTTGTCATACTTTAGATGATGATCAATAGAGAATAAACTGGTTTAGGAATTTAGCAACGAGCTACGCCTTTTTCTTTAATCAGGGAACTTCGTATAACG
GAATGGGCTAAAGGGAGTATAGAAAACACACAAACTACCAGTTGTGAAGATATGAAATGGATTATAAAATAAGAAAACTTTGAATTTATTTTTCTCCTTC
TATTTTTTTTATTCGATTAACAAATTAGAGTTAATATATGCTTAATTTTCTCTAAAGAACCGGATTGCTAGTTTGTTCGATTAAATCTTAACTTTTTTAA
TTCATGTAGATGAAATTTGCACATCGTAAATGGATGTATAATAGAACTCATCCTATTTGTGTGGGAATGAGGGTGGAATTTAAAAATGGGGTTTAATAAT
TTATTACAATTGAGAAAATTTAAAATTGTATTTTTTATTAAGGCAAAATTCCGTGACTTTGTGCTAAATGCTGCTTACAAAAAAAGATAAATTCAATTCG
CTGATTTTAAGAATGGATTTTTACATCCATTTAATTATCATCTTTTTACCTACATAATCCTGCTTTATGTTTAGTCATATCTTCTTTTTTTCTTTTTTTT
TTTTTTTCCGATATCTCTATTACATATTTTCTTCCCTAGTCTTTTTTATTGAGAACATTAACTAGAGATTGATTTTCTGTATTCAGCTCTATACTATTCA
ATTTATAATTTCA
>LE_HBa0128G13_T7_69049 (trimmed for quality and cloning vector)
AGCTTTAAGATTTATCAAACATCATATTAATCTTGGTCACAATAATCCAGCCAAATGATTTTCTCTTTGGACCCTTATCTATCATCCAAACCCATATTAT
AGCTAGTCTTCCTGGTTTGTTTCATCATATTTTAATCATATTGACCTAGTGTATTTTGTCATACTTTAGATGATGATCAATAGAGAATAAACTGGTTTAG
GAATTTAGCAACGAGCTACGCCTTTTTCTTTAATCAGGGAACTTCGTATAACGGAATGGGCTAAAGGGAGTATAGAAAACACACAAACTACCAGTTGTGA
AGATATGAAATGGATTATAAAATAAGAAAACTTTGAATTTATTTTTCTCCTTCTATTTTTTTTATTCGATTAACAAATTAGAGTTAATATATGCTTAATT
TTCTCTAAAGAACCGGATTGCTAGTTTGTTCGATTAAATCTTAACTTTTTTAATTCATGTAGATGAAATTTGCACATCGTAAATGGATGTATAATAGAAC
TCATCCTATTTGTGTGGGAATGAGGGTGGAATTTAAAAATGGGGTTTAATAATTTAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.924756
Expected error %
0.284284
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0128G13
Clone
Clone name
hba-128g13
LE_HBa0128G13
P128G13
Clone type
BAC
Contamination
none
Estimated length
82,712
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found