Clone Read LE_HBa0128L09_SP6_69280

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0128L09_SP6_69280
Primer
SP6
ID from Seq. Facility
LE_HBa_128_L09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
662 trimmed for vector and quality, 837 raw
Genbank Accession
Sequence
>LE_HBa0128L09_SP6_69280 (raw untrimmed)
GGTAATCTATGGATTGGTCGATCCTATACAAATTATGTTGTATTTGAATAGTAAATATTAGTTTAGCAGGAGAGGATCTGTAATAACCACAAAAAAAAAA
AAATCTATTGTAAAACCCTAGACATCATATATATATATATACTAATGTGGGAATTGATCGTATTTCTTATTCTGATACTTATAATAGTGTATTTTTATAT
ATAATCAAAATTTTTTTACTGATTAAATTAAAAGTGATGTAATCTCATTGATTCCGATTATTGTACCACACTAGATTAAATGTTGTAGGAGATCATCATG
TGGATTGTGGATGCAAAGAGTGTGAAAAGGTCATGTGAGAGCACCATTCTAGGGTTCTTCAATGCACCCTTAAAACCATAATTGTAGGATATTTTTTGGG
GTCCTTAAGGCCACTTCATTTGGTAACATATAACGTGCATCCCCACGTTATACCATAACTCATTGTTCTAACCACAAAAAATTAAAACCACACCAACATT
TTGTTCCCTTTACTAAAATAAAACAACCCCCCACCCAATGAAACAAAATTGAAATAATAGAATTGTTCAAAAATCTTATTATATATATAGAGAGAGAATA
TATGATATATCACATCATGAAAAATTAATTATTATTTTTTTGAAAAGAAAAACTCAACCATTTAGTGAATTAACCTTTTTTTTACGAAGAAAAAACCTTT
TTTTAAAATATTTTTCTTTTGAAAATAAGCTGCTTGAGAAAATGAGAGAAATGATTTTACTTTATGGACGTAAAAAAAAAAGCAAGTTCCTATAAATAAG
TTGAATATTTTTTAAATTCTTTTTTTCCTTCCCCTCC
>LE_HBa0128L09_SP6_69280 (trimmed for quality and cloning vector)
TTGTATTTGAATAGTAAATATTAGTTTAGCAGGAGAGGATCTGTAATAACCACAAAAAAAAAAAAATCTATTGTAAAACCCTAGACATCATATATATATA
TATACTAATGTGGGAATTGATCGTATTTCTTATTCTGATACTTATAATAGTGTATTTTTATATATAATCAAAATTTTTTTACTGATTAAATTAAAAGTGA
TGTAATCTCATTGATTCCGATTATTGTACCACACTAGATTAAATGTTGTAGGAGATCATCATGTGGATTGTGGATGCAAAGAGTGTGAAAAGGTCATGTG
AGAGCACCATTCTAGGGTTCTTCAATGCACCCTTAAAACCATAATTGTAGGATATTTTTTGGGGTCCTTAAGGCCACTTCATTTGGTAACATATAACGTG
CATCCCCACGTTATACCATAACTCATTGTTCTAACCACAAAAAATTAAAACCACACCAACATTTTGTTCCCTTTACTAAAATAAAACAACCCCCCACCCA
ATGAAACAAAATTGAAATAATAGAATTGTTCAAAAATCTTATTATATATATAGAGAGAGAATATATGATATATCACATCATGAAAAATTAATTATTATTT
TTTTGAAAAGAAAAACTCAACCATTTAGTGAATTAACCTTTTTTTTACGAAGAAAAAACCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.914801
Expected error %
0.152649
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0128L09
Clone
Clone name
hba-128l9
LE_HBa0128L09
C04HBa0128L09
P128L09
Clone type
BAC
Contamination
none
Estimated length
73,477
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found