Clone Read LE_HBa0136E02_T7_69699

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0136E02_T7_69699
Primer
T7
ID from Seq. Facility
LE_HBa_136_E02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
798 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0136E02_T7_69699 (raw untrimmed)
AATAACTTCGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAGATGAGATAGTCATACCCTTAAATATGGTATCAGCGGTTCTAT
AATCAAATCTAATACCCTTTTGAACTTATTGACATACTTTATATTATTGTTGTTGATTTCTAGTCTATCTCTAGAATAATAAGTTTATTCTTTCTGGTAC
ACAAACTTTATTTTTGATATATCAGCTGGGGCATTATTTTGGATGTGATCTCTTTGTTTATTAATGGTAAAGCTGTCGTTATTCTGTTTGGACTTCAACC
CCACTATTAAATTAGCCCCAAATAAGAAGAAACTTGACTATTAAATACTGAAAAATTATTGTAGTCTGGTGTAACAGAAATGGTACAAGATTCCTCAACT
TCAATTTCATACACAAAACACCAAAGTTGATAATTATTGGAATTAACTTATGTGATATGACATACTGTATGATAATTGTTAACAGTACTCTCTTATTATC
TTATTCTTCGATTTTGAAATTACATGTTATTTCCTTTGTTTCAATTATCGTGTTATTTGTATTACTAAAAATGGTCCAAATTTGTCGTCCGTTAATAGTT
AAACCATATAAATTTCCAACTCTCTCCACCAAAATGTACACCTAGGAAGTTTAGTTTTCATTTGAACATCAAAGATTAGGAAACAAGAATGAGCAAACTA
CACATATTGATAATACCATATCCAGTACAAGGCCATGTTATTCCCTTAATGCAGCTAGCTCAATCCTTAGCTAAATATGGCTTCAAGATCACTTTTGTCA
ACACAGAGTCCACACACAAGAGTATTCTGAATTCTTTATCAGGAAAA
>LE_HBa0136E02_T7_69699 (trimmed for quality and cloning vector)
AGCTTTTAGATGAGATAGTCATACCCTTAAATATGGTATCAGCGGTTCTATAATCAAATCTAATACCCTTTTGAACTTATTGACATACTTTATATTATTG
TTGTTGATTTCTAGTCTATCTCTAGAATAATAAGTTTATTCTTTCTGGTACACAAACTTTATTTTTGATATATCAGCTGGGGCATTATTTTGGATGTGAT
CTCTTTGTTTATTAATGGTAAAGCTGTCGTTATTCTGTTTGGACTTCAACCCCACTATTAAATTAGCCCCAAATAAGAAGAAACTTGACTATTAAATACT
GAAAAATTATTGTAGTCTGGTGTAACAGAAATGGTACAAGATTCCTCAACTTCAATTTCATACACAAAACACCAAAGTTGATAATTATTGGAATTAACTT
ATGTGATATGACATACTGTATGATAATTGTTAACAGTACTCTCTTATTATCTTATTCTTCGATTTTGAAATTACATGTTATTTCCTTTGTTTCAATTATC
GTGTTATTTGTATTACTAAAAATGGTCCAAATTTGTCGTCCGTTAATAGTTAAACCATATAAATTTCCAACTCTCTCCACCAAAATGTACACCTAGGAAG
TTTAGTTTTCATTTGAACATCAAAGATTAGGAAACAAGAATGAGCAAACTACACATATTGATAATACCATATCCAGTACAAGGCCATGTTATTCCCTTAA
TGCAGCTAGCTCAATCCTTAGCTAAATATGGCTTCAAGATCACTTTTGTCAACACAGAGTCCACACACAAGAGTATTCTGAATTCTTTATCAGGAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.937358
Expected error %
0.457238
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g02100.1 Score 66 E Value 3e-11 Identity 17.60% Align. Length 152bp (19.05%) Frame 2
68416.m00176 UDP-glucoronosyl/UDP-glucosyl transferase family protein contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0136E02
Clone
Clone name
hba-136e2
LE_HBa0136E02
C02HBa0136E02
P136E02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found