Clone Read LE_HBa0136G17_SP6_69824

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0136G17_SP6_69824
Primer
SP6
ID from Seq. Facility
LE_HBa_136_G17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
672 trimmed for vector and quality, 843 raw
Genbank Accession
Sequence
>LE_HBa0136G17_SP6_69824 (raw untrimmed)
ATATACTTTCAACATGGAAAATAGGACAAAACATTACCATTCTAGTAAGCATTGTGTTGGACTTAGACACTCCCTTTACTAATATTAACCTTTTGCAATG
GCTGGGTTAGCAGCTTGTAAAGGAAACATAATCTTAAATCCTTAATGTTTATTTTATATAGCTAGATTGAAATGAACCTAATGATATCATAACCAGAAAA
CCTGAACAGTTGAAAGGTATAGTGTAAGACAAACAATTGCAACAAGGAGAGCAAACTGACCAGCAAATGTCCTTGCAGAGTTCCACTGCCAAAACTAAAC
GAAGCCCCCTTTTTCGAGTTCTTGTTCTCGCTAACATAAACAACCTGTAGAGGCATCATAAGCCACGGGAAGAACTCCTTCACACAAACACAGAACTTTG
TCCCACTTTGAATTTGAGCTTTTGGATCAACAAACGCCCAATTCAATCCAAAATGCCTGCAAAGTTAGTTTGGTACATAATCAGACCATTGATCGCATGA
TATTTCTACAAGAATAACTGATATACCAAACCTCCAATTTTGAAGGGCAGCTTTTCCCTTTTCAAAAGTCTCACGGCCTGAACCGACTAATACTCGAGCA
CAATTAACAGAGAAACCATCCTTTGCAAGCTCACTGTCTTGCTTAAGTAGAGGAGCAGGTTTCTCAGTAGTTCCTCTAAATCTTTTTATCATAGTTAAAG
GAACCAGACCTGTTACAGACGAAACCCTCAATAATGATTCCCACAATTAAACCCAAAGAAAGGGAAATAAAAAAATTACTCATTTCTATTTTCATTTTGT
TGAATTGACCAGAATTTAAATCCTAAAAAAAACCATACGTAAA
>LE_HBa0136G17_SP6_69824 (trimmed for quality and cloning vector)
GGAAAATAGGACAAAACATTACCATTCTAGTAAGCATTGTGTTGGACTTAGACACTCCCTTTACTAATATTAACCTTTTGCAATGGCTGGGTTAGCAGCT
TGTAAAGGAAACATAATCTTAAATCCTTAATGTTTATTTTATATAGCTAGATTGAAATGAACCTAATGATATCATAACCAGAAAACCTGAACAGTTGAAA
GGTATAGTGTAAGACAAACAATTGCAACAAGGAGAGCAAACTGACCAGCAAATGTCCTTGCAGAGTTCCACTGCCAAAACTAAACGAAGCCCCCTTTTTC
GAGTTCTTGTTCTCGCTAACATAAACAACCTGTAGAGGCATCATAAGCCACGGGAAGAACTCCTTCACACAAACACAGAACTTTGTCCCACTTTGAATTT
GAGCTTTTGGATCAACAAACGCCCAATTCAATCCAAAATGCCTGCAAAGTTAGTTTGGTACATAATCAGACCATTGATCGCATGATATTTCTACAAGAAT
AACTGATATACCAAACCTCCAATTTTGAAGGGCAGCTTTTCCCTTTTCAAAAGTCTCACGGCCTGAACCGACTAATACTCGAGCACAATTAACAGAGAAA
CCATCCTTTGCAAGCTCACTGTCTTGCTTAAGTAGAGGAGCAGGTTTCTCAGTAGTTCCTCTAAATCTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964364
Expected error %
0.177234
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g17695.1 Score 125 E Value 2e-29 Identity 16.50% Align. Length 356bp (52.98%) Frame 1
68415.m02049 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAC42945.1| Score 125 E Value 7e-28 Identity 16.50% Align. Length 356bp (52.98%) Frame 1
unknown protein [Arabidopsis thaliana] gb|AAO63992.1| unknown protein [Arabidopsis thaliana] ref|NP_849965.1| expressed protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_471065.1| Score 84 E Value 4e-15 Identity 12.80% Align. Length 311bp (46.28%) Frame 1
OSJNBa0020P07.10 [Oryza sativa (japonica cultivar-group)] emb|CAE01293.2| OSJNBa0020P07.10 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0136G17
Clone
Clone name
hba-136g17
LE_HBa0136G17
C02HBa0136G17
P136G17
Clone type
BAC
Contamination
none
Estimated length
81,536
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found