Clone Read LE_HBa0136J01_T7_69937

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0136J01_T7_69937
Primer
T7
ID from Seq. Facility
LE_HBa_136_J01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
766 trimmed for vector and quality, 838 raw
Genbank Accession
Sequence
>LE_HBa0136J01_T7_69937 (raw untrimmed)
ATTAACCTGGTTCCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATGCCAAGTTCTCTAAGTCTGTATGGTGCCTAGATGCAGTGTCCTT
CTTGGGGCACGTGCTTTCTGAGGATGGAGTGATGGTGGACCCTTCTAAGATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGG
AGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCTATTGCTTCCCAATTGACGAACTTGACTAAGCAGAATGTTCCATTTG
TATGGTCGGACGAATGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCTATCCTTACCTTGCCAGTAGAGGGTAAGAACTTCATTGT
TTATTGTGATGCATCCTATTCTGGGTTGGGTGCAGTACTAATGCAAGAGAAGAGTGTGATTGCTTATGCTTCAAGACAATTAAAAGTGCATGAACGTAAC
TATCCAACTCATGACTTGGAATTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGACACTATTTATATGGGTTTAAGTGTGAGGTCTACACGGATCATC
GTAGCCTTCAGTATGTCTTTACTCAGAAAGATTTGAACTTAAGACAGAGGAGATGGATGGAACTACTGAAGGACTACGACATCACTATTTTGTATCATCC
GGGGAAGGCAAATGTTGTGGCGGATGCTTTAAGTAGAAAAGCGGGAAGCATGGGAAGTCTAGCTCACTTGCCAGTTTCTAGACGTCCATTGGCTAGAGAG
GTTCAGACTCTGGCTAACGGCTTGATGAAGGCTAAAGT
>LE_HBa0136J01_T7_69937 (trimmed for quality and cloning vector)
AGCTTTATGCCAAGTTCTCTAAGTCTGTATGGTGCCTAGATGCAGTGTCCTTCTTGGGGCACGTGCTTTCTGAGGATGGAGTGATGGTGGACCCTTCTAA
GATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTC
TCTTCTATTGCTTCCCAATTGACGAACTTGACTAAGCAGAATGTTCCATTTGTATGGTCGGACGAATGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGT
TGACTACCGCACCTATCCTTACCTTGCCAGTAGAGGGTAAGAACTTCATTGTTTATTGTGATGCATCCTATTCTGGGTTGGGTGCAGTACTAATGCAAGA
GAAGAGTGTGATTGCTTATGCTTCAAGACAATTAAAAGTGCATGAACGTAACTATCCAACTCATGACTTGGAATTGGCTGCGGTAGTGTTTGCATTAAAG
CAATGGAGACACTATTTATATGGGTTTAAGTGTGAGGTCTACACGGATCATCGTAGCCTTCAGTATGTCTTTACTCAGAAAGATTTGAACTTAAGACAGA
GGAGATGGATGGAACTACTGAAGGACTACGACATCACTATTTTGTATCATCCGGGGAAGGCAAATGTTGTGGCGGATGCTTTAAGTAGAAAAGCGGGAAG
CATGGGAAGTCTAGCTCACTTGCCAGTTTCTAGACGTCCATTGGCTAGAGAGGTTCAGACTCTGGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.977089
Expected error %
0.734418
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 365 E Value 1e-100 Identity 23.10% Align. Length 761bp (99.35%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 364 E Value 1e-99 Identity 23.10% Align. Length 761bp (99.35%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0136J01
Clone
Clone name
hba-136j1
LE_HBa0136J01
C03HBa0136J01
P136J01
Clone type
BAC
Contamination
none
Estimated length
54,717
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found