Clone Read LE_HBa0136J18_SP6_69970

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0136J18_SP6_69970
Primer
SP6
ID from Seq. Facility
LE_HBa_136_J18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
695 trimmed for vector and quality, 751 raw
Genbank Accession
Sequence
>LE_HBa0136J18_SP6_69970 (raw untrimmed)
ATTTCTTTAAAAATAAATTTATATTTTGAATTCAACGAAAAATGCATATGGAGAGAATATTTAATATAAAAAACCTTTATCGTTTCTGTTTTATGACTTA
ATAAATATATGAAGCGCTTAAGAGGTGGTGGGAGTATATATCTTGTTTAAAATGAATATATACATATCCTAAATCATACAAACAAATTATTACTACTGTT
CATGGTGTAATAATTTCATTTCTCCCTTTTTGTGATTAAAAACCTTTGCAAGTAATGGATACAAGACATAGAAGCATTAGAATAGCAATGTTACCATGGC
TAGCTCATGGTCACATAACACCTTTTATAGAGCTAGCCAAAGCACTTTCAAATAGAAATTTCTACATCTACATATGTTCCACACAAGTCAATATCAATTC
ATTCAAACAAACAATATCTGAAAAACACTCAATTTCAATAAAAATAGTTGAAATTCATCTTCCAAATTTACCAAACCTTCCTCCACACTACCACACAACT
AATGGACTTCCACCTCATCTCATGTCAACTCTTAAAAATGCAATGGACATGGCTCAACCTAGTTTTTACCATATACTTACTACTTTGAAACCAGATTTAG
TTATTTATGATTTTCTTCAACCATGGGTTCCAACTTTGGCTGCTTCATTGAATATACCTTCTGTTTTGTTTTTAACCCCTGGTGCTGCTGCATGTTCTTA
TCTATTTCATATTGGTAAAAAAAAAAACTGGTTTGTGAATACCCTTTTTCC
>LE_HBa0136J18_SP6_69970 (trimmed for quality and cloning vector)
ATTCAACGAAAAATGCATATGGAGAGAATATTTAATATAAAAAACCTTTATCGTTTCTGTTTTATGACTTAATAAATATATGAAGCGCTTAAGAGGTGGT
GGGAGTATATATCTTGTTTAAAATGAATATATACATATCCTAAATCATACAAACAAATTATTACTACTGTTCATGGTGTAATAATTTCATTTCTCCCTTT
TTGTGATTAAAAACCTTTGCAAGTAATGGATACAAGACATAGAAGCATTAGAATAGCAATGTTACCATGGCTAGCTCATGGTCACATAACACCTTTTATA
GAGCTAGCCAAAGCACTTTCAAATAGAAATTTCTACATCTACATATGTTCCACACAAGTCAATATCAATTCATTCAAACAAACAATATCTGAAAAACACT
CAATTTCAATAAAAATAGTTGAAATTCATCTTCCAAATTTACCAAACCTTCCTCCACACTACCACACAACTAATGGACTTCCACCTCATCTCATGTCAAC
TCTTAAAAATGCAATGGACATGGCTCAACCTAGTTTTTACCATATACTTACTACTTTGAAACCAGATTTAGTTATTTATGATTTTCTTCAACCATGGGTT
CCAACTTTGGCTGCTTCATTGAATATACCTTCTGTTTTGTTTTTAACCCCTGGTGCTGCTGCATGTTCTTATCTATTTCATATTGGTAAAAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.928414
Expected error %
0.597981
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g49690.1 Score 80 E Value 1e-15 Identity 10.40% Align. Length 452bp (65.04%) Frame 2
68418.m06152 UDP-glucoronosyl/UDP-glucosyl transferase family protein contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g65550.1 Score 71 E Value 5e-13 Identity 9.40% Align. Length 416bp (59.86%) Frame 2
68418.m08248 UDP-glucoronosyl/UDP-glucosyl transferase family protein contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase ;similar to flavonol 3-O-glucosyltransferase (anthocyanin rhamnosyl transferase) from Petunia hybrida [SP|Q43716]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL06646.1| Score 138 E Value 1e-31 Identity 15.80% Align. Length 455bp (65.47%) Frame 2
flavonoid 1-2 rhamnosyltransferase [Citrus maxima]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD77944.1| Score 133 E Value 4e-30 Identity 14.10% Align. Length 452bp (65.04%) Frame 2
UDP-glucuronic acid:anthocyanin glucuronosyltransferase [Bellis perennis]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0136J18
Clone
Clone name
hba-136j18
LE_HBa0136J18
P136J18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found