Clone Read LE_HBa0136J18_T7_69971

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0136J18_T7_69971
Primer
T7
ID from Seq. Facility
LE_HBa_136_J18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
702 trimmed for vector and quality, 889 raw
Genbank Accession
Sequence
>LE_HBa0136J18_T7_69971 (raw untrimmed)
ATTAACTTGGGACCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCAGGAACTCAAGACCTTGCTGTATTACTGCACCTATCCTTACCTTG
CCAGTGGAAGGAAAGAACTTCGTTGTTTATTGTGATGCATCCTATTCTGGTTTGAGTGCAGTGCTAATGCAAGAGAAGAGTGTAATTGCTTATGCTTCGA
GGCAATTAAAGGTGCATGAACATAATTATCCTACCCATGATTTGGAGTTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGACATTATCTATATGGGGT
GAAGTGTGAAGTCTATACAGATCATCGTAGTTTACAGAATGTCTTTACTCAGAAAGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTGAAGGAT
TATGATGTTACCATCTTGTATCACCCAGGAAAGGCTAATGTTGTGGCAGACGCCTTAAGTAGAAAAGCAGGGAGCATGGGTAGTTTAGCCCACTTACAAG
CTTCTAGAAGCCCATTGGCTAGAGAGGTTCAGACTCTAGCTAACGACTTTATGAGGTTAAAAGTAAATGAGAAGGGAGGATTTTTGGCCAGTGTGGAGGC
GAGATCTTCTTTTCTTGACAAGATCAAGGGAAAACAGTTTGATGATGAGAAACTAAGCCGAATTCGAGATATGGTGTTGCGAGGAGAGGCTAAAGAAGCA
ATAATGGATGAGGAAGGTGTTTTGAGAATTAAGGGAAGGGTATGTGTGCCCTCGTGTTGAGTATTTAATCCACCCCATTCTTTCAGAGGCTCATAGTCCC
GGATATTCTACACGTTCTGGTGGCAACCCAAATGTACCGGGGACCCAAAGCAACCTTTTTTGCGGTAGTAAATGTAACCCGCTTTTTTT
>LE_HBa0136J18_T7_69971 (trimmed for quality and cloning vector)
AGCTTTCAGGAACTCAAGACCTTGCTGTATTACTGCACCTATCCTTACCTTGCCAGTGGAAGGAAAGAACTTCGTTGTTTATTGTGATGCATCCTATTCT
GGTTTGAGTGCAGTGCTAATGCAAGAGAAGAGTGTAATTGCTTATGCTTCGAGGCAATTAAAGGTGCATGAACATAATTATCCTACCCATGATTTGGAGT
TGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGACATTATCTATATGGGGTGAAGTGTGAAGTCTATACAGATCATCGTAGTTTACAGAATGTCTTTAC
TCAGAAAGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTGAAGGATTATGATGTTACCATCTTGTATCACCCAGGAAAGGCTAATGTTGTGGCA
GACGCCTTAAGTAGAAAAGCAGGGAGCATGGGTAGTTTAGCCCACTTACAAGCTTCTAGAAGCCCATTGGCTAGAGAGGTTCAGACTCTAGCTAACGACT
TTATGAGGTTAAAAGTAAATGAGAAGGGAGGATTTTTGGCCAGTGTGGAGGCGAGATCTTCTTTTCTTGACAAGATCAAGGGAAAACAGTTTGATGATGA
GAAACTAAGCCGAATTCGAGATATGGTGTTGCGAGGAGAGGCTAAAGAAGCAATAATGGATGAGGAAGGTGTTTTGAGAATTAAGGGAAGGGTATGTGTG
CC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963225
Expected error %
0.606047
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 305 E Value 6e-82 Identity 21.30% Align. Length 698bp (99.43%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 303 E Value 3e-81 Identity 21.50% Align. Length 698bp (99.43%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0136J18
Clone
Clone name
hba-136j18
LE_HBa0136J18
P136J18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found