Clone Read LE_HBa0136P04_T7_70231

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0136P04_T7_70231
Primer
T7
ID from Seq. Facility
LE_HBa_136_P04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
721 trimmed for vector and quality, 794 raw
Genbank Accession
Sequence
>LE_HBa0136P04_T7_70231 (raw untrimmed)
AAAAAACTGGGTACCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCTAGGTCTGGTTTTCCTTCCATTAGTATCAAAAGAAGTACTTGTTT
TGATTTGATTCATGTTGATTTCTAGGATCCTTATAAAACACCTATTTTTTATGGTAACAAGTACTTCATTACAATGGTATTTCTACTTAAATGTAAGTCT
GATGTGTGTATTTCTCTTAAACTATTTATGCACTATGTTAGGACTCAATTAGGGAGAAATGTTAAGGTATTAAGGTCTCACAATGGGACTGATTTTGCTA
ACTCTGTGTGCACTGCTTTGTTCAAAGAGTTGGGAATTATACACGAGAGGTCTTGTCCATATACCTATCAAACTAGGGTTGTTGATAGAAAAATAGACAT
ATACTTGAAGTAACTAGGGCACAAAAAATGTATGCACACATTCCATTGTAAGAATACATGTCATTTTCAGAGAAAACAATCCTATTTTAACAGCAACCAG
GTATCTTGACAAACAATCCTCCATATGATCTTGTGGGAAAACAAATTTGTATTACTTCAACTCAAAATACAATTGTTTTACAAAGGGAGTTAACGTAGCA
TTATTCGTGCGATGATGATAAACGCTTGCATCTTGAGAAGTGAGTTTTGTGACGATTTATGTTGGCTAGACTTTATGACTTTCTCAGTTCAGATTCAATA
ATCTTAATTTTGTTTATTTCAATCATAAGTTCACCATTCAGTATGACTTGATAATTTCCATTAAAGGGGTTCATAATAAAGTCTTAAGCTATAT
>LE_HBa0136P04_T7_70231 (trimmed for quality and cloning vector)
AGCTTGCTAGGTCTGGTTTTCCTTCCATTAGTATCAAAAGAAGTACTTGTTTTGATTTGATTCATGTTGATTTCTAGGATCCTTATAAAACACCTATTTT
TTATGGTAACAAGTACTTCATTACAATGGTATTTCTACTTAAATGTAAGTCTGATGTGTGTATTTCTCTTAAACTATTTATGCACTATGTTAGGACTCAA
TTAGGGAGAAATGTTAAGGTATTAAGGTCTCACAATGGGACTGATTTTGCTAACTCTGTGTGCACTGCTTTGTTCAAAGAGTTGGGAATTATACACGAGA
GGTCTTGTCCATATACCTATCAAACTAGGGTTGTTGATAGAAAAATAGACATATACTTGAAGTAACTAGGGCACAAAAAATGTATGCACACATTCCATTG
TAAGAATACATGTCATTTTCAGAGAAAACAATCCTATTTTAACAGCAACCAGGTATCTTGACAAACAATCCTCCATATGATCTTGTGGGAAAACAAATTT
GTATTACTTCAACTCAAAATACAATTGTTTTACAAAGGGAGTTAACGTAGCATTATTCGTGCGATGATGATAAACGCTTGCATCTTGAGAAGTGAGTTTT
GTGACGATTTATGTTGGCTAGACTTTATGACTTTCTCAGTTCAGATTCAATAATCTTAATTTTGTTTATTTCAATCATAAGTTCACCATTCAGTATGACT
TGATAATTTCCATTAAAGGGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944272
Expected error %
0.799051
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 95 E Value 4e-20 Identity 45.50% Align. Length 487bp (67.55%) Frame 1
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC67205.1| Score 81 E Value 2e-14 Identity 14.90% Align. Length 335bp (46.46%) Frame 1
putative retroelement pol polyprotein [Arabidopsis thaliana] pir||D84481 probable retroelement pol polyprotein [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0136P04
Clone
Clone name
hba-136p4
LE_HBa0136P04
P136P04
Clone type
BAC
Contamination
none
Estimated length
100,887
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found