Clone Read LE_HBa0138D18_T7_70451

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0138D18_T7_70451
Primer
T7
ID from Seq. Facility
LE_HBa_138_D18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
717 trimmed for vector and quality, 800 raw
Sequence
>LE_HBa0138D18_T7_70451 (raw untrimmed)
CTTCGGTCCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGTAGAGAAACACTCACAAGACCTTCAAAACACGTGTTCAAGTTCATCAAT
AATAAAATGTGCAATGCCATGAGATGCAATGTCAAGTATAGTGATGCATGTCTTTCCTAACGACACACACCCGTTGTCTCTTAGTCTACGACCCATGGGG
GACATATCTGTCCATGCATATGTCGCGGCGTACGACACGACCCTCGATAATAGTAACATTCACGGTGCGCGATACGTCCCTCGAAATATAATATCCATCG
CGGTGCGCGATACGATCCTCAAAATGGTACATCCTCTTACCACAACCATGTCTCAGATACAATGCAAATGACATGCTCGAATGAAAATGAGGAGATAATC
ACTTTGATAACAGAGCACAATTTACAAAAAGGAATACAACACCAACAAATAAGTAACAAGTCTCCAAGTCATTCTCAACACCACACAAGGAAATACACAA
ATTTCATACGCTTAACAAGAGTTTAGAAATCCACTTGCCTTAGTCAATCGAATAATTACTCTTGGACTTGAGCCTTCCCTTTCCGTTGAGCATCCAAACC
AATGGAATCTATTCAAGTATATATTCACAATAAGGTTTCAGAACTAACAATACTCACACTTTTATGTGTTTAACCTTGACCTAAAAATACACCCCAAATT
TATAATCAAGTTTGTAATTCTTTGATGTCCAATTAACATTTCAACTATCATAGATTTTTAAAGTTTTAAGCCTAGGAATAAATTTCAATTAAATTACTTT
>LE_HBa0138D18_T7_70451 (trimmed for quality and cloning vector)
AGCTTCGTAGAGAAACACTCACAAGACCTTCAAAACACGTGTTCAAGTTCATCAATAATAAAATGTGCAATGCCATGAGATGCAATGTCAAGTATAGTGA
TGCATGTCTTTCCTAACGACACACACCCGTTGTCTCTTAGTCTACGACCCATGGGGGACATATCTGTCCATGCATATGTCGCGGCGTACGACACGACCCT
CGATAATAGTAACATTCACGGTGCGCGATACGTCCCTCGAAATATAATATCCATCGCGGTGCGCGATACGATCCTCAAAATGGTACATCCTCTTACCACA
ACCATGTCTCAGATACAATGCAAATGACATGCTCGAATGAAAATGAGGAGATAATCACTTTGATAACAGAGCACAATTTACAAAAAGGAATACAACACCA
ACAAATAAGTAACAAGTCTCCAAGTCATTCTCAACACCACACAAGGAAATACACAAATTTCATACGCTTAACAAGAGTTTAGAAATCCACTTGCCTTAGT
CAATCGAATAATTACTCTTGGACTTGAGCCTTCCCTTTCCGTTGAGCATCCAAACCAATGGAATCTATTCAAGTATATATTCACAATAAGGTTTCAGAAC
TAACAATACTCACACTTTTATGTGTTTAACCTTGACCTAAAAATACACCCCAAATTTATAATCAAGTTTGTAATTCTTTGATGTCCAATTAACATTTCAA
CTATCATAGATTTTTAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961105
Expected error %
0.955716
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0138D18
Clone
Clone name
hba-138d18
LE_HBa0138D18
P138D18
Clone type
BAC
Contamination
none
Estimated length
109,126
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found