Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0033K21_T7_7049

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0033K21_T7_7049
Primer
T7
ID from Seq. Facility
LE_HBa_033_K21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
850 trimmed for vector and quality, 896 raw
Genbank Accession
Sequence
>LE_HBa0033K21_T7_7049 (raw untrimmed)
ACCCGGGTACCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATGGGCAATCTCTTACCCTCCTAATCTTATTCAAAGTTAAACTAGAAA
CCCTCGAGACTAGTCTCATGATGGAAGTTGTATTGTACTCGCTCTCTGACATTGCCATGTTAAATTGCTATTTAATTTTCTTTTTTTCCCACTTGTTCTT
TTCTCCAATATATCTTCATTTCCTTCTATTTCGACATTACATGATAACTTTCCACTCCATCAAATTCTCTGCAATCACCTATTTTACCCTTTCACTGCCA
TTAAGCTGCCACATTTCCTCCACTGCAAAACCCATTGCTGTATTTTCTCCATTACAAAACTCTTGACCCCCACCCTATAACTCTCTCTCACAGGAAACCT
CTCTGCACCTTCACCTATATATCCATTCCCCCAAACAGACCAAAGTCTCACCTTTCTCTCCATGGATATACCTTATACAGGCAGCTTCCATCCACAGAAA
ACCCAGGACAACTGTTCTCCATAGACGCTGCTTTCAACCCCCAAAGCTACGGCAGAGACCTTCTTCCTTCCTTCACCCATTCTTCAGGATCAAAAGTTAT
ATTTTGCTGGAATAGCTTGTGTTGTACTGTTGAGATGGAGTATGTTCGAAAGCTTGTATTTTGAAATTGAATGTGATTGAACTGATATAATTATGAATTT
TTAAGCACTCTTATTTTGGTTAATTCTACCTTATATGTTGTCTAAAAATATTAAGTCACTCGGGTGTGGTTTGATATTTCAATAGATCTCATTAAAATAC
TCCACAGAGGAAAAAAAGATAGTCTTCCTTCTCTAATGATGTTTTTCAGAAGCAATCATTCTGCTGGACTTGTCTCTGGGAAAAAAGAGTAAAATA
>LE_HBa0033K21_T7_7049 (trimmed for quality and cloning vector)
AGCTTTATGGGCAATCTCTTACCCTCCTAATCTTATTCAAAGTTAAACTAGAAACCCTCGAGACTAGTCTCATGATGGAAGTTGTATTGTACTCGCTCTC
TGACATTGCCATGTTAAATTGCTATTTAATTTTCTTTTTTTCCCACTTGTTCTTTTCTCCAATATATCTTCATTTCCTTCTATTTCGACATTACATGATA
ACTTTCCACTCCATCAAATTCTCTGCAATCACCTATTTTACCCTTTCACTGCCATTAAGCTGCCACATTTCCTCCACTGCAAAACCCATTGCTGTATTTT
CTCCATTACAAAACTCTTGACCCCCACCCTATAACTCTCTCTCACAGGAAACCTCTCTGCACCTTCACCTATATATCCATTCCCCCAAACAGACCAAAGT
CTCACCTTTCTCTCCATGGATATACCTTATACAGGCAGCTTCCATCCACAGAAAACCCAGGACAACTGTTCTCCATAGACGCTGCTTTCAACCCCCAAAG
CTACGGCAGAGACCTTCTTCCTTCCTTCACCCATTCTTCAGGATCAAAAGTTATATTTTGCTGGAATAGCTTGTGTTGTACTGTTGAGATGGAGTATGTT
CGAAAGCTTGTATTTTGAAATTGAATGTGATTGAACTGATATAATTATGAATTTTTAAGCACTCTTATTTTGGTTAATTCTACCTTATATGTTGTCTAAA
AATATTAAGTCACTCGGGTGTGGTTTGATATTTCAATAGATCTCATTAAAATACTCCACAGAGGAAAAAAAGATAGTCTTCCTTCTCTAATGATGTTTTT
CAGAAGCAATCATTCTGCTGGACTTGTCTCTGGGAAAAAAGAGTAAAATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951928
Expected error %
0.452922
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0033K21
Clone
Clone name
hba-33k21
LE_HBa0033K21
P033K21
Clone type
BAC
Contamination
none
Estimated length
109,766
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found