Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0138F10_SP6_70530

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0138F10_SP6_70530
Primer
SP6
ID from Seq. Facility
LE_HBa_138_F10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
636 trimmed for vector and quality, 873 raw
Sequence
>LE_HBa0138F10_SP6_70530 (raw untrimmed)
GTTTCAATATGTGATTTCAAAATTGAAAGAAAATACAAGTTTCAAATGACATTGGTTTCTAGAATAAAACAAGATTATTATTAAGGAGAAACAAGGTCTG
TTGAAATGACAAGCAACTACCTCACAAACCTCTACAAGAAGGCTCAGACAAGGAAAAGAGAAAATATCACAACAATTGGGGCTAAAATAACCTACAAAAA
ATGTAGTAGTAAGGAGTGAGTACCAACCACACGGTACTCACCAAGTAAACCTCTAAACACAAATTAAGGGGATAAAATATGGGGTACTCCTTATACACCA
ACCTAACCTCGACAACTACAACCTGCATAAAAATCAACACAATCTAATAATCCACAATTTACATAACACCCAACTCAACAATAATAACTTTAACAAATTA
AATATCCGTTACAACAAACTCTAAATTCATCAATAACAACTTCTACAAAAATAATGCACCTACAATAGCAACAATACAAGATCAAGTTCATAAGATAGAG
GTAATCAAATATCAAGTATTTTCCAACAACCAATAAAACATAAAAACATCAAGAATGAAGGATGTCATGGGATGCAATGCAATATTTCACCATGAAATGA
CGTGTCTCAGAATGCCAAGTACTCTCCCAACCGTACATACTTGATAATCCTTGAAATACATTAAGAGTTCATGAACCATGTGGGACTCGCGAGGTCCATA
TATCGATCTAGATGATCTACACGTGTTTTGTATGGATGAATGCAACACACTATCATAAATTCAAACAATCCCCAGCCCAAAACGAACTCCACCTTGGCCA
AACTTATAATCATTAACCAATTCCTTTGCCCGGATGAATTCTCCTGGTTAAACCTTTTACTCATAACTCAATT
>LE_HBa0138F10_SP6_70530 (trimmed for quality and cloning vector)
TTGAAAGAAAATACAAGTTTCAAATGACATTGGTTTCTAGAATAAAACAAGATTATTATTAAGGAGAAACAAGGTCTGTTGAAATGACAAGCAACTACCT
CACAAACCTCTACAAGAAGGCTCAGACAAGGAAAAGAGAAAATATCACAACAATTGGGGCTAAAATAACCTACAAAAAATGTAGTAGTAAGGAGTGAGTA
CCAACCACACGGTACTCACCAAGTAAACCTCTAAACACAAATTAAGGGGATAAAATATGGGGTACTCCTTATACACCAACCTAACCTCGACAACTACAAC
CTGCATAAAAATCAACACAATCTAATAATCCACAATTTACATAACACCCAACTCAACAATAATAACTTTAACAAATTAAATATCCGTTACAACAAACTCT
AAATTCATCAATAACAACTTCTACAAAAATAATGCACCTACAATAGCAACAATACAAGATCAAGTTCATAAGATAGAGGTAATCAAATATCAAGTATTTT
CCAACAACCAATAAAACATAAAAACATCAAGAATGAAGGATGTCATGGGATGCAATGCAATATTTCACCATGAAATGACGTGTCTCAGAATGCCAAGTAC
TCTCCCAACCGTACATACTTGATAATCCTTGAAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.914113
Expected error %
0.170634
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0138F10
Clone
Clone name
hba-138f10
LE_HBa0138F10
P138F10
Clone type
BAC
Contamination
none
Estimated length
106,710
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found