Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0138F10_T7_70531

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0138F10_T7_70531
Primer
T7
ID from Seq. Facility
LE_HBa_138_F10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
704 trimmed for vector and quality, 823 raw
Sequence
>LE_HBa0138F10_T7_70531 (raw untrimmed)
TCGGGTCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGTATTAGAGCATAAAATTTTGGGATAATAGTACGGTTGATGCCACACACCA
CCATGTCAAGTAGAGTCTTATTCATAATGTGAAACACTCCACCTTTATGAATAGGAGGTTCTAAGATGATTAGGAACCCTTCTTTCTTTATTATTCTATG
ATCGTGGTGGAGTCTTAACACTATGTATTTAACTCATTCCTTATAATCCATTTCATGTGCTTATAGTCCTTGAATACAATGAGGGATAATGATAGTTGGG
TCGAAGAGAAAAATGTGAATGAGGAGGTTCCCCCTCATAGTTGAGATAAGGTCTTCCATCTATAGTTTGACTCAAGTGTTGGATACTCAAATTGATAAAG
ATGATATGGTGAAAGTGAATCCCAATGCTAGCACCACTTCTTCAAGAATAAGGAATTTCACAAGGATTAATAACCCTAAGTTCTTTGACTCTAAGGTGGA
AGAATACCCACAAGAATTTATAGATGAAGTATTCAAGGGGGGAGATGCCATGAGAGTGACCTCTCAAGAAAAGGTGAAACTAGTCGTCTATCAACTCAAA
GAAGTGGCTTAAGTTTGATATGAACAATAGAAGGCTGAGAGGTCGGTTAGGGAAGGACAGATTACTTGGAACGGGGCTTTCAAAATGTCTTTCCTTGATA
GGTTCTTTCCCTTGGAATTAAGAGAGATAAAAATGCAAGAATTCATCAATCTTCCGCAAGAGAATATGAGTGTGAAGGAGTATAGCCTCCAGTTTTACTC
CAAAATCAAAGTTTGATCCCTTC
>LE_HBa0138F10_T7_70531 (trimmed for quality and cloning vector)
AGCTTGGTATTAGAGCATAAAATTTTGGGATAATAGTACGGTTGATGCCACACACCACCATGTCAAGTAGAGTCTTATTCATAATGTGAAACACTCCACC
TTTATGAATAGGAGGTTCTAAGATGATTAGGAACCCTTCTTTCTTTATTATTCTATGATCGTGGTGGAGTCTTAACACTATGTATTTAACTCATTCCTTA
TAATCCATTTCATGTGCTTATAGTCCTTGAATACAATGAGGGATAATGATAGTTGGGTCGAAGAGAAAAATGTGAATGAGGAGGTTCCCCCTCATAGTTG
AGATAAGGTCTTCCATCTATAGTTTGACTCAAGTGTTGGATACTCAAATTGATAAAGATGATATGGTGAAAGTGAATCCCAATGCTAGCACCACTTCTTC
AAGAATAAGGAATTTCACAAGGATTAATAACCCTAAGTTCTTTGACTCTAAGGTGGAAGAATACCCACAAGAATTTATAGATGAAGTATTCAAGGGGGGA
GATGCCATGAGAGTGACCTCTCAAGAAAAGGTGAAACTAGTCGTCTATCAACTCAAAGAAGTGGCTTAAGTTTGATATGAACAATAGAAGGCTGAGAGGT
CGGTTAGGGAAGGACAGATTACTTGGAACGGGGCTTTCAAAATGTCTTTCCTTGATAGGTTCTTTCCCTTGGAATTAAGAGAGATAAAAATGCAAGAATT
CATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957687
Expected error %
0.157475
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38733.1| Score 143 E Value 5e-33 Identity 19.40% Align. Length 407bp (57.81%) Frame 1
putative retrotransposon gag protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39945.1| Score 86 E Value 9e-16 Identity 12.30% Align. Length 404bp (57.39%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0138F10
Clone
Clone name
hba-138f10
LE_HBa0138F10
P138F10
Clone type
BAC
Contamination
none
Estimated length
106,710
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found