Clone Read LE_HBa0138F21_T7_70553

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0138F21_T7_70553
Primer
T7
ID from Seq. Facility
LE_HBa_138_F21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
667 trimmed for vector and quality, 784 raw
Sequence
>LE_HBa0138F21_T7_70553 (raw untrimmed)
CTTTGGTCCCTGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCCAACCTTTGATTTAATCAAGGTTTTGTGTCCATGTCGTATAACTGGGT
AAGAAGAGTCGTATGACGACCTTGTAGATTGGTAAGAGGATGATCTTCCTCTACCCCTGCTGTTTCTTCCTCCTCGACCACGAATATGTGACCATGGAGG
TTCATTACCTCCCGCCATCCTGGAAAGACGAACAAACTTTAATAATTATCAAAATGTCCTTCGATGTCATATTCCCAATTATTATCATCTAGGGAAACAA
TTTCATAATCATGGAGGAAATCTTCAATTAGAATACTATCAAATATTCTATCAATAATAGTTTCTTTTAAATTTGTACTTAATGACTGTAAAGCTATAAA
AATTGTAATAAGAGTCTTATTTCCAAATACAAAACTATAAGGAGACATTTTAATTATTTAGAAATTCTCTGGATAAGAAATCAGGAAGAGAGTTATCACT
TCCCTTTTTATAATGAATTTCAAAATCAAAAGGAGCTAACTGTGCTTGCCACCTAGCAAACATTAATTTTGATATATCGTGCTTGAAGTCTTTATCAAAA
ATATACTTAATTGACTGAGCATCAATTCTTATAATAAATTTTTTGATTATATAAGTCATCTTGGGAATTTTAATACCACATTTTAACCACACAAAGCATT
TCCTTGAGCCACAGTCCCATATTTTCGCTTGTGAATCAGACCCCTTCCCAAAAATGAAATTCTAAAGGGGTATTCTATTTTGGC
>LE_HBa0138F21_T7_70553 (trimmed for quality and cloning vector)
AGCTTCTCCAACCTTTGATTTAATCAAGGTTTTGTGTCCATGTCGTATAACTGGGTAAGAAGAGTCGTATGACGACCTTGTAGATTGGTAAGAGGATGAT
CTTCCTCTACCCCTGCTGTTTCTTCCTCCTCGACCACGAATATGTGACCATGGAGGTTCATTACCTCCCGCCATCCTGGAAAGACGAACAAACTTTAATA
ATTATCAAAATGTCCTTCGATGTCATATTCCCAATTATTATCATCTAGGGAAACAATTTCATAATCATGGAGGAAATCTTCAATTAGAATACTATCAAAT
ATTCTATCAATAATAGTTTCTTTTAAATTTGTACTTAATGACTGTAAAGCTATAAAAATTGTAATAAGAGTCTTATTTCCAAATACAAAACTATAAGGAG
ACATTTTAATTATTTAGAAATTCTCTGGATAAGAAATCAGGAAGAGAGTTATCACTTCCCTTTTTATAATGAATTTCAAAATCAAAAGGAGCTAACTGTG
CTTGCCACCTAGCAAACATTAATTTTGATATATCGTGCTTGAAGTCTTTATCAAAAATATACTTAATTGACTGAGCATCAATTCTTATAATAAATTTTTT
GATTATATAAGTCATCTTGGGAATTTTAATACCACATTTTAACCACACAAAGCATTTCCTTGAGCCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.939382
Expected error %
0.78414
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0138F21
Clone
Clone name
hba-138f21
LE_HBa0138F21
C12HBa0138F21
P138F21
Clone type
BAC
Contamination
none
Estimated length
78,504
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found