Clone Read LE_HBa0138J02_T7_70707

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0138J02_T7_70707
Primer
T7
ID from Seq. Facility
LE_HBa_138_J02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
526 trimmed for vector and quality, 772 raw
Sequence
>LE_HBa0138J02_T7_70707 (raw untrimmed)
CTCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTGCAGGACCGTCCTGGACCCTTTGGTCCCTTATGCAGATCTCTAAGATAC
AATGGACCCACTTTATGGATTCTTTCATTCATAAAGTGAAATTTTTCCGATATTTAACACCAATCTTATAGACCCTACAAGCCAGTGTAGCTCCTCAACA
CAATATTATTCAAAGGTAGATCAAAGGACATAACCAACCATTCTAACAAACTCCGGGGACACATCAATACTGTCCTTCTCCTTAAAAAAGAATATTGTAA
TCAAACAAAACTTGTCAGGAAGATGGACGTCTTCCTCATCCCTTTCGACATCCTTTTTAATGCTAAACTACCTCAGGGACCACTGAAGGTGGTCTTTTCA
TGATCTTTTGATACGATAGAAATATGTTGGGATCTCTAACGCTCCTCACACCCTCCCGAGAGTGCTTCTTTGTCTATATTGTATTCCCTGAAAGGGGTGG
AGACACGGTCTTTCTTCAACCAAACATTCATCTTTTGCTACCATATGCAATGTCACGACCCTATTACTGGTCACAATTGTAATAAACTGGTTACTCTCTT
AGAGTACAACAATCGTGGCGCCATTGTTGGGCTCACAGGATATAAGACACGCTGACATGTTGTCCGCATAAAGCTAGATGACTCCTGCTTGCATTCTCTT
GATGATCTACCCTTTAATTACATCTTGCAGAAGTGGAATCCAACTTGCAGTGTTGCTGATAAATCTTCTCTG
>LE_HBa0138J02_T7_70707 (trimmed for quality and cloning vector)
AGCTTGTGCAGGACCGTCCTGGACCCTTTGGTCCCTTATGCAGATCTCTAAGATACAATGGACCCACTTTATGGATTCTTTCATTCATAAAGTGAAATTT
TTCCGATATTTAACACCAATCTTATAGACCCTACAAGCCAGTGTAGCTCCTCAACACAATATTATTCAAAGGTAGATCAAAGGACATAACCAACCATTCT
AACAAACTCCGGGGACACATCAATACTGTCCTTCTCCTTAAAAAAGAATATTGTAATCAAACAAAACTTGTCAGGAAGATGGACGTCTTCCTCATCCCTT
TCGACATCCTTTTTAATGCTAAACTACCTCAGGGACCACTGAAGGTGGTCTTTTCATGATCTTTTGATACGATAGAAATATGTTGGGATCTCTAACGCTC
CTCACACCCTCCCGAGAGTGCTTCTTTGTCTATATTGTATTCCCTGAAAGGGGTGGAGACACGGTCTTTCTTCAACCAAACATTCATCTTTTGCTACCAT
ATGCAATGTCACGACCCTATTACTGG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959219
Expected error %
6.62924
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0138J02
Clone
Clone name
hba-138j2
LE_HBa0138J02
C03HBa0138J02
P138J02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found