Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0145G05_T7_71337

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0145G05_T7_71337
Primer
T7
ID from Seq. Facility
LE_HBa_145_G05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
527 trimmed for vector and quality, 884 raw
Genbank Accession
Sequence
>LE_HBa0145G05_T7_71337 (raw untrimmed)
TTAGTCTGGGCCCCGGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCTTTTCTTTCCAAATCTCATCACTCCCTTCATATGTGACACTTTC
AGAAAAACTCAATCATCAATTTGGAACTCCAAGTCCTTTTTCCTTAGATCTGCACAGTATTTCTGTCGACTCTTGGCTATCTTAAGTCTATCTGGAACGA
TATGAACTTTTTCCATGACATAATGAACCAAAAATGTTCCTATCAAGTCTACTTCACCTACTTCAAACAAACCAACTGGAGATTTGCATCTACGCCCATA
TAATGCATCATGTGAGGCCATCTGAATGCTGGAATGGTAGCTTTTATTTTTGGCAAATTTTATACGAGGAAGGCTATCATCCATCCTTCCCTTGAAATAG
ATCACCAAGATCTCAACATTTCTCTAAGGTCTGAATCGTACGCTCTGCTTGACCATCATGTGCGTATGAAATGTTGTGCTAATGTTAACCTGAGTACCAA
GACCTTTCGAAAATGATTTCCTAAAATGAGAGGTAAACTGACGACCTATATATGAGATAATAGAGAAAGGGACTGAATTCAATCTGTCTCTCTTATTTAT
TTAATGCTAAGCGTATTCTTCCAGTGAGTCTTTAGTTCTAAACAACCTAAAAGTTTATAAACTTTAGTATCTCCATCAACTATTACTTAGATTGAGTAAT
GTTGTTTTCTGATAGGAAGTTAACTTGTAAGCACTCGATGTTTGTTATTTCCTCTTACTATTATGATTCTTTCCTCTTATTTCTTTTCTTTTTTGTTCCT
CACCTCTTTCTATTCAGAAAACTCTCTCCGCTTCCTCAACTCCAATTTTTCTTTTCCTCCCTTCCCCTTCATTACTCCCTCTTC
>LE_HBa0145G05_T7_71337 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTCCTTTTCTTTCCAAATCTCATCACTCCCTTCATATGTGACACTTTCAGAAAAACTCAATCATCAATTTGGAACTCCAAGT
CCTTTTTCCTTAGATCTGCACAGTATTTCTGTCGACTCTTGGCTATCTTAAGTCTATCTGGAACGATATGAACTTTTTCCATGACATAATGAACCAAAAA
TGTTCCTATCAAGTCTACTTCACCTACTTCAAACAAACCAACTGGAGATTTGCATCTACGCCCATATAATGCATCATGTGAGGCCATCTGAATGCTGGAA
TGGTAGCTTTTATTTTTGGCAAATTTTATACGAGGAAGGCTATCATCCATCCTTCCCTTGAAATAGATCACCAAGATCTCAACATTTCTCTAAGGTCTGA
ATCGTACGCTCTGCTTGACCATCATGTGCGTATGAAATGTTGTGCTAATGTTAACCTGAGTACCAAGACCTTTCGAAAATGATTTCCTAAAATGAGAGGT
AAACTGACGACCTATATATGAGATAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961941
Expected error %
0.33616
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 183 E Value 2e-45 Identity 19.20% Align. Length 515bp (97.72%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 183 E Value 2e-45 Identity 19.20% Align. Length 515bp (97.72%) Frame 1
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0145G05
Clone
Clone name
hba-145g5
LE_HBa0145G05
P145G05
Clone type
BAC
Contamination
none
Estimated length
87,341
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found