Clone Read LE_HBa0145L07_SP6_71580

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0145L07_SP6_71580
Primer
SP6
ID from Seq. Facility
LE_HBa_145_L07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
673 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0145L07_SP6_71580 (raw untrimmed)
GTTTTATTAACTGGCTTTCCCTAATTTACATGTATTTCCATCTCCTTTCCTTTCTAGGACGTGTTTATTGATCAATTCGATATTTTTGTTTTTGTTTTTT
AGAAATGTCATACCAATGCCATACAGAAATAAATTCGATATGGCTTTTTGGGTTATCGTGGATCTAGGGTCAAATATACACTTTAGTTATCTTCTTTTGT
TGAGTTTCATACCTAAACTATCAAATTTCCTATCTATATCATCGCTAGGTTTATAACACCAACACATCTCAATTAGCTATTGTTCACTTTTCCTACCTAA
AATATCAGTAATTGAAGGAAAATTGAACAACTGGTACAGTTATATTGAGATAAATATTTGGTAATAACTACATAGAGAGCTCACACCTAATAAGCCAGTA
TTAATCTTTGAAAGTCAAGTTTAATACATTTTTCTAGTTCCATGAAGAAATTTACCAAGCTTCTCTTAAAACATTTTTCGTGTACGAAAATAGAATTCAT
GAACTAAATTTTCTGGTATGCTGGTTCATGACTTTTTATCAGACCACATTCGATCCAAATTTAATCAGGTCTGGTCAAAAAAAGGTTTAAGGTCACAAAT
AACCACAAACGGAACGATTATCGTTCACGCAATAAGAAAAAAAAGAAGGTAAAACAGGCATACCACCTAAGAAAATCAAACATGCACAAAAATGCTAAGC
AACAACTGAAAGATAGTAAAGCCCATAGTTCAGTTCTATTTGCACACACACCGGTTGTTCCGGAAAATACAACATTATCCCTTATCTACAGCTACTGGTG
CATAGTTGTCCAACATTCCACAAAGTTCTTATTAAATAAAACCCACCAAAAA
>LE_HBa0145L07_SP6_71580 (trimmed for quality and cloning vector)
AATTTACATGTATTTCCATCTCCTTTCCTTTCTAGGACGTGTTTATTGATCAATTCGATATTTTTGTTTTTGTTTTTTAGAAATGTCATACCAATGCCAT
ACAGAAATAAATTCGATATGGCTTTTTGGGTTATCGTGGATCTAGGGTCAAATATACACTTTAGTTATCTTCTTTTGTTGAGTTTCATACCTAAACTATC
AAATTTCCTATCTATATCATCGCTAGGTTTATAACACCAACACATCTCAATTAGCTATTGTTCACTTTTCCTACCTAAAATATCAGTAATTGAAGGAAAA
TTGAACAACTGGTACAGTTATATTGAGATAAATATTTGGTAATAACTACATAGAGAGCTCACACCTAATAAGCCAGTATTAATCTTTGAAAGTCAAGTTT
AATACATTTTTCTAGTTCCATGAAGAAATTTACCAAGCTTCTCTTAAAACATTTTTCGTGTACGAAAATAGAATTCATGAACTAAATTTTCTGGTATGCT
GGTTCATGACTTTTTATCAGACCACATTCGATCCAAATTTAATCAGGTCTGGTCAAAAAAAGGTTTAAGGTCACAAATAACCACAAACGGAACGATTATC
GTTCACGCAATAAGAAAAAAAAGAAGGTAAAACAGGCATACCACCTAAGAAAATCAAACATGCACAAAAATGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.932749
Expected error %
0.114824
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0145L07
Clone
Clone name
hba-145l7
LE_HBa0145L07
P145L07
Clone type
BAC
Contamination
none
Estimated length
87,102
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found