Clone Read LE_HBa0145L07_T7_71581

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0145L07_T7_71581
Primer
T7
ID from Seq. Facility
LE_HBa_145_L07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
683 trimmed for vector and quality, 898 raw
Genbank Accession
Sequence
>LE_HBa0145L07_T7_71581 (raw untrimmed)
AATTATCGGGCCCGGGGGGTACTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGAAATGTCCAGTGCCAGTATCCTTGCGACGGAATGAATTGGCCTATG
CAATCTTTTACCAAGTTTCTGCCTATAAGTCAGTCGTCAAGCTTAGAAACTGCTTGTTATTGATTTTTGGAGATTTCCCGCTTTCATGTGATAATAGCAA
CGGGATCATTTTCTATGTCGTCGGAATCCTTAGCTTTGCACATGTCTTAGTTATATTCTTCTGTTAATGAAACATACCATTTTGTGGTACAGGTACCTGA
AACGTTGTCAGAAGAGGTGCTAGCGAAAATGAGTGCACCTCCAAAGAGTGATGTGCCTATAATAACACCACAAGAACTTGCTGAAGCTGATGGTTTCGTT
TTTGGATTCCCTACAAGGTTCGGAATGATGTCCGCTCAGTTTAAAGCATTCCTTGATGCAACTGGAGGTCTATGGAGAACACAACAACTAGCTGGCAAGC
CTGCAGGCATATTCTATAGCACTGGATCCCAAGGCGGTGGACAAGAAACAACACCGTATGATCTTATTTCACATAAATTCATATGACTAAACATGATAAA
ACTGTCTTTCTCTTCCTTGTTATAGTTTTTAACCCGAGGTACATGATAGGTTGACTGCTATAACTCAACTTGTTCACCATGGAATGATATTTGTACTCAT
CGGATACACATTCGGTGTTGGCATGTTTTGAAATGTGAAAACGTGATAGGAGGAAGTGTATTTGGAGTTAGAACATTTGCTGGTTGATGGCACTAGACAC
CATCTGAGTTTCATTTCTTTCAGGCCAACACCTAGGATTAATCTTCGCTCCACTTGCCTTGCCCCATGGTCTTTACTTTTTCGCCTTGAGGATTTTCT
>LE_HBa0145L07_T7_71581 (trimmed for quality and cloning vector)
AGCTTAGAAATGTCCAGTGCCAGTATCCTTGCGACGGAATGAATTGGCCTATGCAATCTTTTACCAAGTTTCTGCCTATAAGTCAGTCGTCAAGCTTAGA
AACTGCTTGTTATTGATTTTTGGAGATTTCCCGCTTTCATGTGATAATAGCAACGGGATCATTTTCTATGTCGTCGGAATCCTTAGCTTTGCACATGTCT
TAGTTATATTCTTCTGTTAATGAAACATACCATTTTGTGGTACAGGTACCTGAAACGTTGTCAGAAGAGGTGCTAGCGAAAATGAGTGCACCTCCAAAGA
GTGATGTGCCTATAATAACACCACAAGAACTTGCTGAAGCTGATGGTTTCGTTTTTGGATTCCCTACAAGGTTCGGAATGATGTCCGCTCAGTTTAAAGC
ATTCCTTGATGCAACTGGAGGTCTATGGAGAACACAACAACTAGCTGGCAAGCCTGCAGGCATATTCTATAGCACTGGATCCCAAGGCGGTGGACAAGAA
ACAACACCGTATGATCTTATTTCACATAAATTCATATGACTAAACATGATAAAACTGTCTTTCTCTTCCTTGTTATAGTTTTTAACCCGAGGTACATGAT
AGGTTGACTGCTATAACTCAACTTGTTCACCATGGAATGATATTTGTACTCATCGGATACACATTCGGTGTTGGCATGTTTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973668
Expected error %
1.01056
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g27270.1 Score 148 E Value 3e-36 Identity 25.20% Align. Length 293bp (42.90%) Frame 1
68417.m03914 quinone reductase family protein similar to 1,4-benzoquinone reductase [Phanerochaete chrysosporium][GI:4454993]; similar to Trp repressor binding protein [Escherichia coli][SP|P30849]; contains flavodoxin domain PF00258
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g54500.1 Score 140 E Value 8e-34 Identity 29.40% Align. Length 227bp (33.24%) Frame 1
68418.m06786 quinone reductase, putative similar to 1,4-benzoquinone reductase [Phanerochaete chrysosporium][GI:4454993]; contains flavodoxin domain PF00258
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ65137.1| Score 148 E Value 1e-34 Identity 25.20% Align. Length 293bp (42.90%) Frame 1
At4g27270 [Arabidopsis thaliana] dbj|BAD95300.1| putative protein [Arabidopsis thaliana] ref|NP_194457.2| quinone reductase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79582.1| Score 147 E Value 2e-34 Identity 27.20% Align. Length 260bp (38.07%) Frame 1
putative protein [Arabidopsis thaliana] emb|CAA19721.1| putative protein [Arabidopsis thaliana] pir||T05751 hypothetical protein M4I22.80 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0145L07
Clone
Clone name
hba-145l7
LE_HBa0145L07
P145L07
Clone type
BAC
Contamination
none
Estimated length
87,102
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found